Быстрый заказ

Человек CIRBP / Cold-inducible RNA-binding Белок Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human CIRBP Информация о продукте «Клон cDNA»
Размер кДНК:519bp
Описание кДНК:Full length Clone DNA of Homo sapiens cold inducible RNA binding protein with N terminal Flag tag.
Синоним гена:CIRP
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек CIRBP / Cold-inducible RNA-binding Белок Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Человек CIRBP / Cold-inducible RNA-binding Белок Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14578-ACGRBS15400
Человек CIRBP / Cold-inducible RNA-binding Белок Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14578-ACRRBS15400
Человек CIRBP / Cold-inducible RNA-binding Белок Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14578-ANGRBS15400
Человек CIRBP / Cold-inducible RNA-binding Белок Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14578-ANRRBS15400
Человек CIRBP / Cold-inducible RNA-binding Белок Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14578-CFRBS13340
Человек CIRBP / Cold-inducible RNA-binding Белок Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14578-CHRBS13340
Человек CIRBP / Cold-inducible RNA-binding Белок Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14578-CMRBS13340
Человек CIRBP / Cold-inducible RNA-binding Белок Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14578-CYRBS13340
Человек CIRBP / Cold-inducible RNA-binding Белок Джин клон кДНК в вектор клонированияHG14578-GRBS5130
Человек CIRBP / Cold-inducible RNA-binding Белок Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14578-NFRBS13340
Человек CIRBP / Cold-inducible RNA-binding Белок Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14578-NHRBS13340
Человек CIRBP / Cold-inducible RNA-binding Белок Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14578-NMRBS13340
Человек CIRBP / Cold-inducible RNA-binding Белок Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14578-NYRBS13340
Человек CIRBP / Cold-inducible RNA-binding Белок Джин ORF экспрессии кДНК клона плазмидыHG14578-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

CIRBP, also known as cold-inducible RNA-binding protein, plays a protective role in the genotoxic stress response by stabilizing transcripts of genes involved in cell survival. CIRBP responds to a wide array of cellular stresses, including short wavelength ultraviolet light (UVC), at the transcriptional and post-translational level. It acts as a translational activator.CIRBP can bind the 3 translated region of specific transcripts to stabilize them and facilitate their transport to ribosomes for translation. CIRBP affects NF-κB signaling as opposed to IL1B mRNA stability directly.

  • Artero-Castro A. et al., 2009, Mol Cell Biol. 29 (7): 1855-68.
  • Zeng Y. et al., 2009, J Cell Biochem. 107 (1): 179-88.
  • Brochu C. et al., 2013, PLoS One. 8 (2): e57426.
  • Size / Price
    Каталог: HG14578-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.