CHST12 cDNA ORF Clone, Human, N-His tag

Price:
Size:
Number:

CHST12 cDNA ORF Clone, Human, N-His tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1245 bp
Description
Full length Clone DNA of Human carbohydrate (chondroitin 4) sulfotransferase 12 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CHST12 cDNA ORF Clone, Human, N-His tag: Alternative Names

C4S-2 cDNA ORF Clone, Human; C4ST-2 cDNA ORF Clone, Human; C4ST2 cDNA ORF Clone, Human

CHST12 Background Information

Full Name
carbohydrate (chondroitin 4) sulfotransferase 12
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait