Быстрый заказ

Человек CHST12 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human CHST12 Информация о продукте «Клон cDNA»
Размер кДНК:1245bp
Описание кДНК:Full length Clone DNA of Homo sapiens carbohydrate (chondroitin 4) sulfotransferase 12 with N terminal His tag.
Синоним гена:C4S-2, C4ST2, C4ST-2, CHST12
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек CHST12 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек CHST12 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12308-ACGRBS15400
Человек CHST12 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12308-ACRRBS15400
Человек CHST12 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12308-CFRBS13340
Человек CHST12 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12308-CHRBS13340
Человек CHST12 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12308-CMRBS13340
Человек CHST12 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12308-CYRBS13340
Человек CHST12 Джин клон кДНК в вектор клонированияHG12308-GRBS5130
Человек CHST12 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12308-NFRBS13340
Человек CHST12 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12308-NHRBS13340
Человек CHST12 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12308-NMRBS13340
Человек CHST12 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12308-NYRBS13340
Человек CHST12 Джин ORF экспрессии кДНК клона плазмидыHG12308-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG12308-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.