After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек CHST11 / C4ST-1 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human CHST11 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001173982.1
Размер кДНК:1059bp
Описание кДНК:Full length Clone DNA of Homo sapiens carbohydrate (chondroitin 4) sulfotransferase 11 with N terminal His tag.
Синоним гена:C4ST, C4ST1, C4ST-1, HSA269537, CHST11
Виды:Human
переносчик:pCMV3-SP-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек CHST11 / C4ST-1 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек CHST11 / C4ST-1 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11396-ACGRBS15400
Человек CHST11 / C4ST-1 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11396-ACRRBS15400
Человек CHST11 / C4ST-1 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11396-CFRBS13340
Человек CHST11 / C4ST-1 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11396-CHRBS13340
Человек CHST11 / C4ST-1 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11396-CMRBS13340
Человек CHST11 / C4ST-1 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11396-CYRBS13340
Человек CHST11 Gene cDNA clone plasmidHG11396-MRBS5130
Человек CHST11 / C4ST-1 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11396-M-FRBS13340
Человек CHST11 / C4ST-1 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11396-NFRBS13340
Человек CHST11 / C4ST-1 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11396-NHRBS13340
Человек CHST11 / C4ST-1 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11396-NMRBS13340
Человек CHST11 / C4ST-1 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11396-NYRBS13340
Человек CHST11 / C4ST-1 transcript variant 2 Джин ORF экспрессии кДНК клона плазмидыHG11396-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

CHST11, also known as C4ST-1, belongs to the sulfotransferase 2 family. CHST11 localizes to the golgi membrane, and catalyzes the transfer of sulfate to position 4 of the N-acetylgalactosamine (GalNAc) residue of chondroitin. Chondroitin sulfate constitutes the predominant proteoglycan present in cartilage, and is distributed on the surfaces of many cells and extracellular matrices. A chromosomal translocation involving CHST11 gene and IgH, t(12;14)(q23;q32), has been reported in a patient with B-cell chronic lymphocytic leukemia.

Ссылки
  • Hiraoka N. et al., 2000, J Biol Chem. 275 (26): 20188-96.
  • Schmidt HH. et al., 2004, Oncogene. 23 (41): 6991-6.
  • Okuda T. et al., 2001, J Biochem. 128 (5): 763-70.
  • Size / Price
    Каталог: HG11396-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».