Быстрый заказ

Человек CHRNA5/NACHRA5 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек CHRNA5 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:BC033639
    Размер кДНК:1407bp
    Описание кДНК:Full length Clone DNA of Homo sapiens cholinergic receptor, nicotinic, alpha 5 (neuronal) with N terminal His tag.
    Синоним гена:LNCR2
    Виды:Human
    переносчик:pCMV3-SP-N-His
    Plasmid:
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CHRNA5 qPCR primers for gene expression analysis, HP103471 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Человек CHRNA5/NACHRA5 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
    Человек CHRNA5/NACHRA5 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14840-ACGRBS15400
    Человек CHRNA5/NACHRA5 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14840-ACRRBS15400
    Человек CHRNA5/NACHRA5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14840-CFRBS13340
    Человек CHRNA5/NACHRA5 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14840-CHRBS13340
    Человек CHRNA5/NACHRA5 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14840-CMRBS13340
    Человек CHRNA5/NACHRA5 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14840-CYRBS13340
    Человек CHRNA5/NACHRA5 Джин клон кДНК в вектор клонированияHG14840-GRBS5130
    Человек CHRNA5/NACHRA5 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14840-NFRBS13340
    Человек CHRNA5/NACHRA5 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14840-NHRBS13340
    Человек CHRNA5/NACHRA5 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14840-NMRBS13340
    Человек CHRNA5/NACHRA5 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14840-NYRBS13340
    Человек CHRNA5/NACHRA5 Джин ORF экспрессии кДНК клона плазмидыHG14840-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».