Быстрый заказ

Человек CHP1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек CHP1 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_007236.4
    Размер кДНК:588bp
    Описание кДНК:Full length Clone DNA of Homo sapiens calcineurin-like EF-hand protein 1 with N terminal His tag.
    Синоним гена:CHP, SLC9A1BP
    Виды:Human
    переносчик:pCMV3-N-His
    Plasmid:
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CHP1 qPCR primers for gene expression analysis, HP101260 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Человек CHP1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
    Человек CHP1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11379-ACGRBS15400
    Человек CHP1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11379-ACRRBS15400
    Человек CHP1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG11379-ANGRBS15400
    Человек CHP1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG11379-ANRRBS15400
    Человек CHP1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11379-CFRBS13340
    Человек CHP1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11379-CHRBS13340
    Человек CHP1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11379-CMRBS13340
    Человек CHP1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11379-CYRBS13340
    Человек CHP1 Джин клон кДНК в вектор клонированияHG11379-MRBS5130
    Человек CHP1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11379-M-FRBS13340
    Человек CHP1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11379-NFRBS13340
    Человек CHP1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11379-NHRBS13340
    Человек CHP1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11379-NMRBS13340
    Человек CHP1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11379-NYRBS13340
    Человек CHP1 Джин ORF экспрессии кДНК клона плазмидыHG11379-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».