Быстрый заказ

Человек CHP1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human CHP1 Информация о продукте «Клон cDNA»
Размер кДНК:588bp
Описание кДНК:Full length Clone DNA of Homo sapiens calcineurin-like EF-hand protein 1 with N terminal His tag.
Синоним гена:CHP, SLC9A1BP
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек CHP1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек CHP1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11379-ACGRBS15396
Человек CHP1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11379-ACRRBS15396
Человек CHP1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG11379-ANGRBS15396
Человек CHP1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG11379-ANRRBS15396
Человек CHP1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11379-CFRBS13343
Человек CHP1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11379-CHRBS13343
Человек CHP1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11379-CMRBS13343
Человек CHP1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11379-CYRBS13343
Человек CHP1 Джин клон кДНК в вектор клонированияHG11379-MRBS5132
Человек CHP1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11379-M-FRBS13343
Человек CHP1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11379-NFRBS13343
Человек CHP1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11379-NHRBS13343
Человек CHP1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11379-NMRBS13343
Человек CHP1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11379-NYRBS13343
Человек CHP1 Джин ORF экспрессии кДНК клона плазмидыHG11379-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG11379-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.