Быстрый заказ

Человек CHMP7 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек CHMP7 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:BC019110
    Размер кДНК:1362bp
    Описание кДНК:Full length Clone DNA of Homo sapiens charged multivesicular body protein 7 with N terminal His tag.
    Синоним гена:MGC29816, CHMP7
    Виды:Human
    переносчик:pCMV3-N-His
    Plasmid:
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CHMP7 qPCR primers for gene expression analysis, HP102923 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Человек CHMP7 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
    Человек CHMP7 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14273-ACGRBS15400
    Человек CHMP7 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14273-ACRRBS15400
    Человек CHMP7 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14273-ANGRBS15400
    Человек CHMP7 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14273-ANRRBS15400
    Человек CHMP7 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14273-CFRBS13340
    Человек CHMP7 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14273-CHRBS13340
    Человек CHMP7 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14273-CMRBS13340
    Человек CHMP7 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14273-CYRBS13340
    Человек CHMP7 Джин клон кДНК в вектор клонированияHG14273-GRBS5130
    Человек CHMP7 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14273-NFRBS13340
    Человек CHMP7 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14273-NHRBS13340
    Человек CHMP7 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14273-NMRBS13340
    Человек CHMP7 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14273-NYRBS13340
    Человек CHMP7 Джин ORF экспрессии кДНК клона плазмидыHG14273-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: HG14273-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».