Быстрый заказ

Человек CHMP4C Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек CHMP4C Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:BC014321
    Размер кДНК:702bp
    Описание кДНК:Full length Clone DNA of Homo sapiens charged multivesicular body protein 4C.
    Синоним гена:MGC22825, SNF7-3, Shax3, VPS32C, CHMP4C
    Виды:Human
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CHMP4C qPCR primers for gene expression analysis, HP102891 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Человек CHMP4C Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Человек CHMP4C Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14241-ACGRBS15400
    Человек CHMP4C Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14241-ACRRBS15400
    Человек CHMP4C Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14241-ANGRBS15400
    Человек CHMP4C Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14241-ANRRBS15400
    Человек CHMP4C Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14241-CFRBS13340
    Человек CHMP4C Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14241-CHRBS13340
    Человек CHMP4C Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14241-CMRBS13340
    Человек CHMP4C Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14241-CYRBS13340
    Человек CHMP4C Джин клон кДНК в вектор клонированияHG14241-GRBS5130
    Человек CHMP4C Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14241-NFRBS13340
    Человек CHMP4C Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14241-NHRBS13340
    Человек CHMP4C Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14241-NMRBS13340
    Человек CHMP4C Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14241-NYRBS13340
    Человек CHMP4C Джин ORF экспрессии кДНК клона плазмидыHG14241-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: HG14241-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».