Быстрый заказ

Человек CHMP4B Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек CHMP4B Информация о продукте «Клон cDNA»
    Размер кДНК:675bp
    Описание кДНК:Full length Clone DNA of Homo sapiens charged multivesicular body protein 4B with C terminal His tag.
    Синоним гена:SNF7, CTPP3, Shax1, CHMP4A, SNF7-2, VPS32B, Vps32-2, C20orf178, dJ553F4.4, CHMP4B
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    ( We provide with CHMP4B qPCR primers for gene expression analysis, HP102678 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Человек CHMP4B Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
    Человек CHMP4B Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14022-ACGRBS15400
    Человек CHMP4B Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14022-ACRRBS15400
    Человек CHMP4B Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14022-ANGRBS15400
    Человек CHMP4B Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14022-ANRRBS15400
    Человек CHMP4B Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14022-CFRBS13340
    Человек CHMP4B Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14022-CHRBS13340
    Человек CHMP4B Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14022-CMRBS13340
    Человек CHMP4B Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14022-CYRBS13340
    Человек CHMP4B Джин клон кДНК в вектор клонированияHG14022-GRBS5130
    Человек CHMP4B Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14022-NFRBS13340
    Человек CHMP4B Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14022-NHRBS13340
    Человек CHMP4B Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14022-NMRBS13340
    Человек CHMP4B Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14022-NYRBS13340
    Человек CHMP4B Джин ORF экспрессии кДНК клона плазмидыHG14022-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: HG14022-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.