Быстрый заказ

Человек CHMP2B Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Человек CHMP2B Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC001553
Размер кДНК:642bp
Описание кДНК:Full length Clone DNA of Homo sapiens charged multivesicular body protein 2B with C terminal His tag.
Синоним гена:DMT1, ALS17, VPS2B, VPS2-2, CHMP2.5
Виды:Human
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with CHMP2B qPCR primers for gene expression analysis, HP103230 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек CHMP2B Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек CHMP2B Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14596-ACGRBS15400
Человек CHMP2B Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14596-ACRRBS15400
Человек CHMP2B Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14596-ANGRBS15400
Человек CHMP2B Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14596-ANRRBS15400
Человек CHMP2B Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14596-CFRBS13340
Человек CHMP2B Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14596-CHRBS13340
Человек CHMP2B Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14596-CMRBS13340
Человек CHMP2B Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14596-CYRBS13340
Человек CHMP2B Джин клон кДНК в вектор клонированияHG14596-GRBS5130
Человек CHMP2B Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14596-NFRBS13340
Человек CHMP2B Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14596-NHRBS13340
Человек CHMP2B Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14596-NMRBS13340
Человек CHMP2B Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14596-NYRBS13340
Человек CHMP2B Джин ORF экспрессии кДНК клона плазмидыHG14596-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG14596-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».