Быстрый заказ

Text Size:AAA

Человек CHL1/LICAM2/CALL Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human CHL1 Информация о продукте «Клон cDNA»
Размер кДНК:3675bp
Описание кДНК:Full length Clone DNA of Homo sapiens CHL1 cell adhesion molecule with homology to L1CAM (close homolog of L1) with N terminal Myc tag.
Синоним гена:CHL1, CALL, L1CAM2, FLJ44930, MGC132578
Участок рестрикции:HindIII + XhoI
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек CHL1/LICAM2/CALL Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек CHL1/LICAM2/CALL Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10143-ACGRBS25660
Человек CHL1/LICAM2/CALL Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10143-ACRRBS25660
Человек CHL1/LICAM2/CALL Джин ORF экспрессии кДНК клона плазмидыHG10143-CRBS23610
Человек CHL1/LICAM2/CALL Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10143-CFRBS23610
Человек CHL1/LICAM2/CALL Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10143-CHRBS23610
Человек CHL1/LICAM2/CALL Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10143-CMRBS23610
Человек CHL1/LICAM2/CALL Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10143-CYRBS23610
Человек CHL1/LICAM2/CALL Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10143-NFRBS23610
Человек CHL1/LICAM2/CALL Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10143-NHRBS23610
Человек CHL1/LICAM2/CALL Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10143-NMRBS23610
Человек CHL1/LICAM2/CALL Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10143-NYRBS23610
Человек CHL1/LICAM2/CALL Джин ORF экспрессии кДНК клона плазмидыHG10143-UTRBS23610
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Neural cell adhesion molecule L1-like protein, also known as close homolog of L1 (CHL1) is the prototypic member of the CTF / NF-1 family of transcription factors that serve as a novel calcium signaling pathway-responsive transcription factor and is considered as a member of the largest ctf complementation group, consisting of 30 of 126 ctf mutants isolated. CHL1 is a cell adhesion molecule highly related to L1. It contains structure plan of six extracellular C2-type immunoglobulin (Ig) domains followed by five fibronectin typeⅢ domains linked by a single membrane-spanning region to a short cytoplasmic domain. The extracellular portion of CHL1 is higyly glycosylated and involved them in hemophilic disease.

  • Alevizopoulos A, et al. (1997) Regulation of the Transforming Growth Factor beta-responsive Transcription Factor CTF-1 by Calcineurin and Calcium/ Calmodulin-dependent Protein Kinase IV. The Journal of Biological Chemistry. 272: 23597-605.
  • Gerring SL, et al. (1990) The CHL1 (CTF 1) gene product of Saccharomyces cerevisiae is important for chromosome transmission and normal cell cycle progression in G2 / M. EMBO J. 9 (13): 4347-58.
  • Wei MH, et al. (1998) In silico-initiated cloning and molecular characterization of a novel human member of the L1 gene family of neural cell adhesion molecules. Human Genetics. 103 (3): 355-64.
  • Size / Price
    Каталог: HG10143-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.