Быстрый заказ

Человек CHI3L1/YKL40 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human CHI3L1 Информация о продукте «Клон cDNA»
Размер кДНК:1152bp
Описание кДНК:Full length Clone DNA of Homo sapiens chitinase 3-like 1 (cartilage glycoprotein-39) with N terminal Flag tag.
Синоним гена:GP39, ASRT7, YKL40, YYL-40, HC-gp39, HCGP-3P, FLJ38139, DKFZp686N19119, CHI3L1
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек CHI3L1/YKL40 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Человек CHI3L1/YKL40 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11227-ACGRBS15400
Человек CHI3L1/YKL40 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11227-ACRRBS15400
Человек CHI3L1/YKL40 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11227-CFRBS13340
Человек CHI3L1/YKL40 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11227-CHRBS13340
Человек CHI3L1/YKL40 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11227-CMRBS13340
Человек CHI3L1/YKL40 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11227-CYRBS13340
Человек CHI3L1/YKL40 Джин клон кДНК в вектор клонированияHG11227-MRBS5130
Человек CHI3L1/YKL40 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11227-M-HRBS13340
Человек CHI3L1/YKL40 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11227-NFRBS13340
Человек CHI3L1/YKL40 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11227-NHRBS13340
Человек CHI3L1/YKL40 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11227-NMRBS13340
Человек CHI3L1/YKL40 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11227-NYRBS13340
Человек CHI3L1/YKL40 Джин ORF экспрессии кДНК клона плазмидыHG11227-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Chitinase-3-like protein 1 (CHI3L1) is a secreted heparin-binding glycoprotein whose expression is associated with vascular smooth muscle cell migration. CHI3L1 is expressed at high levels in postconfluent nodular VSMC cultures and at low levels in subconfluent proliferating cultures. CHI3L1 is a tissue-restricted, chitin-binding lectin and member of glycosyl hydrolase family 18. In contrast to many other monocyto / macrophage markers, its expression is absent in monocytes and strong induced during late stages of human macrophage differentiation. Elevated levels of CHI3L1 are associated with disorders exhibiting increased connective tissue turnover, such as rheum atoid, arthritis, osteoarthritis, scleroderma, and cirrhosis of liver, but is produced in cartilage from old donors or patiens with osteoarthritis. CHI3L1 is abnormally expressed in the hippocampus of subjects with schizophrenia and may be involved in the cellular response to various environmental events that are reported to increase the risk of schizophrenia.

  • Zhao XZH, et al. (2007) Functional Variants in the Promoter Region of Chitinase 3-Like 1 (CHI3L1) and Susceptibility to Schizophrenia.The American Journal of Human Genetics. 80 (1): 12-18.
  • Rehli M, et al. (2003) Transcriptional Regulation of CHI3L1, a Marker Gene for Late Stages of Macrophage Differentiation . The Journal of Biological Chemistry. 278: 44058-67.
  • Nishikawa KC, et al. (2003) gp38k (CHI3L1) is a novel adhesion and migration factor for vascular cells. Experimental Cell Research. 287 (1): 79-87
  • Size / Price
    Каталог: HG11227-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.