Быстрый заказ

Text Size:AAA

Человек CHD1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human CHD1 Информация о продукте «Клон cDNA»
Размер кДНК:5130bp
Описание кДНК:Full length Clone DNA of Homo sapiens chromodomain helicase DNA binding protein 1 with N terminal His tag.
Синоним гена:CHD1
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек CHD1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек CHD1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15982-ACGRBS30450
Человек CHD1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15982-ACRRBS30450
Человек CHD1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG15982-ANGRBS30450
Человек CHD1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG15982-ANRRBS30450
Человек CHD1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15982-CFRBS28400
Человек CHD1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15982-CHRBS28400
Человек CHD1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15982-CMRBS28400
Человек CHD1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15982-CYRBS28400
Человек CHD1 Джин клон кДНК в вектор клонированияHG15982-GRBS5130
Человек CHD1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15982-NFRBS28400
Человек CHD1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15982-NHRBS28400
Человек CHD1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15982-NMRBS28400
Человек CHD1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15982-NYRBS28400
Человек CHD1 Джин ORF экспрессии кДНК клона плазмидыHG15982-UTRBS28400
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG15982-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.