After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек CGB7 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human CGB7 Информация о продукте «Клон cDNA»
Размер кДНК:498bp
Описание кДНК:Full length Clone DNA of Homo sapiens chorionic gonadotropin, beta polypeptide 7 with N terminal Myc tag.
Синоним гена:FLJ35403, FLJ43118, CG-beta-a, CGB7
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name

CGB7 (chorionic gonadotropin, beta polypeptide 7) belongs to the glycoprotein hormones subunit beta family. Glycoprotein hormones are heterodimers consisting of a common alpha subunit and an unique beta subunit which confers biological specificity. CGB7 gene is a member of the glycoprotein hormone beta chain family and encodes the beta 7 subunit of chorionic gonadotropin (CG). CG is produced by the trophoblastic cells of the placenta and stimulates the ovaries to synthesize the steroids that are essential for the maintenance of pregnancy. The beta subunit of CG is encoded by 6 genes which are arranged in tandem and inverted pairs on chromosome 19q13.3 and contiguous with the luteinizing hormone beta subunit gene. CGB7 is used as adjunctive therapy in the treatment of obesity. CGB7 also stimulates the ovaries to synthesize the steroids that are essential for the maintenance of pregnancy.

  • Fiddes J.C., et al.,(1980), The cDNA for the beta-subunit of human chorionic gonadotropin suggests evolution of a gene by readthrough into the 3'-untranslated region. Nature 286:684-687.
  • Talmadge K., et al., (1984), Evolution of the genes for the beta subunits of human chorionic gonadotropin and luteinizing hormone.Nature 307:37-40.
  • Policastro P., et al.,(1983), The beta subunit of human chorionic gonadotropin is encoded by multiple genes.J. Biol. Chem. 258:11492-11499.
  • Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.