After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек CGB5/CG-beta Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human CGB5 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC006290
Размер кДНК:498bp
Описание кДНК:Full length Clone DNA of Homo sapiens chorionic gonadotropin, beta polypeptide 5 with N terminal Flag tag.
Синоним гена:HCG
Виды:Human
переносчик:pCMV3-SP-N-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек CGB5/CG-beta Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Человек CGB5/CG-beta Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14574-ACGRBS15396
Человек CGB5/CG-beta Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14574-ACRRBS15396
Человек CGB5/CG-beta Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14574-CFRBS13343
Человек CGB5/CG-beta Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14574-CHRBS13343
Человек CGB5/CG-beta Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14574-CMRBS13343
Человек CGB5/CG-beta Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14574-CYRBS13343
Человек CGB5/CG-beta Джин клон кДНК в вектор клонированияHG14574-GRBS5132
Человек CGB5/CG-beta Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14574-NFRBS13343
Человек CGB5/CG-beta Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14574-NHRBS13343
Человек CGB5/CG-beta Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14574-NMRBS13343
Человек CGB5/CG-beta Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14574-NYRBS13343
Человек CGB5/CG-beta Джин ORF экспрессии кДНК клона плазмидыHG14574-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG14574-NF
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».