Быстрый заказ

Text Size:AAA

Человек CFL1 / cofilin Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human CFL1 Информация о продукте «Клон cDNA»
Размер кДНК:501bp
Описание кДНК:Full length Clone DNA of Homo sapiens cofilin 1 (non-muscle) with N terminal Flag tag.
Синоним гена:CFL
Участок рестрикции:KpnI + XbaI (6kb + 0.55kb)
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human CFL1 Gene Plasmid Map
Human CFL1 natural ORF mammalian expression plasmid, N-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек CFL1 / cofilin Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Человек CFL1 / cofilin Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14544-ACGRBS15400
Человек CFL1 / cofilin Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14544-ACRRBS15400
Человек CFL1 / cofilin Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14544-ANGRBS15400
Человек CFL1 / cofilin Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14544-ANRRBS15400
Человек CFL1 / cofilin Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14544-CFRBS13340
Человек CFL1 / cofilin Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14544-CHRBS13340
Человек CFL1 / cofilin Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14544-CMRBS13340
Человек CFL1 / cofilin Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14544-CYRBS13340
Человек CFL1 / cofilin Джин клон кДНК в вектор клонированияHG14544-GRBS5130
Человек CFL1 / cofilin Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14544-NFRBS13340
Человек CFL1 / cofilin Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14544-NHRBS13340
Человек CFL1 / cofilin Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14544-NMRBS13340
Человек CFL1 / cofilin Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14544-NYRBS13340
Человек CFL1 / cofilin Джин ORF экспрессии кДНК клона плазмидыHG14544-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

CFL1, also known as n-cofilin, is a member of the ADF/Cofilin family. This family comprises three genes: CFL1, CFL2 and DSTN (destrin). ADF/Cofilin family members bind G-actin monomers and depolymerize actin filaments through two mechanisms: severing and increasing the off-rate for actin monomers from the pointed end. Cofilin also binds with other proteins such as myosin, tropomyosin, α-actinin, gelsolin and scruin. These proteins compete with cofilin for actin binding. Сofilin also plays a role in innate immune response. CFL1 contains 1 ADF-H domain and is widely distributed in various tissues. It is important for normal progress through mitosis and normal cytokinesis.

  • Lappalainen P. et al., 1997, Nature. 388 (6637): 78-82.
  • Ichetovkin I. et al., 2000, Cell Motil. 45 (4): 293-306.
  • Carlier MF. et al., 1997, J Cell Biol. 136 (6): 1307-22.
  • Size / Price
    Каталог: HG14544-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    • Human CFL1 natural ORF mammalian expression plasmid, N-Flag tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.