Быстрый заказ

Человек CES3/Carboxylesterase 3 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human CES3 Информация о продукте «Клон cDNA»
Размер кДНК:1716bp
Описание кДНК:Full length Clone DNA of Homo sapiens carboxylesterase 3 with C terminal His tag.
Синоним гена:ES31, FLJ21736, CES3
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек CES3/Carboxylesterase 3 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек CES3/Carboxylesterase 3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11129-ACGRBS16760
Человек CES3/Carboxylesterase 3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11129-ACRRBS16760
Человек CES3/Carboxylesterase 3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11129-CFRBS14710
Человек CES3/Carboxylesterase 3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11129-CHRBS14710
Человек CES3/Carboxylesterase 3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11129-CMRBS14710
Человек CES3/Carboxylesterase 3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11129-CYRBS14710
Человек CES3/Carboxylesterase 3 Джин клон кДНК в вектор клонированияHG11129-MRBS5130
Человек CES3/Carboxylesterase 3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11129-M-FRBS14710
Человек CES3/Carboxylesterase 3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11129-NFRBS14710
Человек CES3/Carboxylesterase 3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11129-NHRBS14710
Человек CES3/Carboxylesterase 3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11129-NMRBS14710
Человек CES3/Carboxylesterase 3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11129-NYRBS14710
Человек CES3/Carboxylesterase 3 Джин ORF экспрессии кДНК клона плазмидыHG11129-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Carboxylesterases hydrolyze esters of short-chain fatty acids and have roles in animals ranging from signal transduction to xenobiotic detoxification. In enzymology, a carboxylesterase is an enzyme that catalyzes the chemical reaction: a carboxylic ester + H2O = an alcohol + a carboxylate. Most enzymes from this group belong to the superfamily of hydrolases with alpha/beta protein fold (so called Alpha/beta hydrolase fold), specifically those acting on carboxylic ester bonds. The carboxylesterase family of evolutionarily related proteins (those with clear sequence homology to each other) includes a number of proteins with different substrate specificities, such as acetylcholinesterases. Carboxylesterase 3, also known as Liver carboxylesterase 31 homolog and CES3, is a endoplasmic reticulum lumen which belongs to the type-B carboxylesterase/lipase family. CES3 is involved in the detoxification of xenobiotics and in the activation of ester and amide prodrugs. CES3 shows low catalytic efficiency for hydrolysis of CPT-11, a prodrug for camptothecin used in cancer therapeutics. CES3 is expressed in liver, colon and small intestine.

  • Augusteyn RC. et al.,1969, Biochim Biophys Acta. 171 (1): 128-37.
  • Saito S. et al., 2003, J. Hum. Genet. 48: 249-70.
  • Sanghani SP. et al., 2003, Clin Cancer Res. 9: 4983-91.
  • Sanghani SP. et al., 2004, Drug Metab Dispos. 32: 505-11.
  • Chen R. et al., 2009, J Proteome Res. 8: 651-61.
  • Size / Price
    Каталог: HG11129-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.