Быстрый заказ

Человек CEPT1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Человек CEPT1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC032610
Размер кДНК:1251bp
Описание кДНК:Full length Clone DNA of Homo sapiens choline/ethanolamine phosphotransferase 1 with N terminal His tag.
Синоним гена:CEPT1
Виды:Human
переносчик:pCMV3-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with CEPT1 qPCR primers for gene expression analysis, HP101913 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек CEPT1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек CEPT1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12309-ACGRBS15400
Человек CEPT1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12309-ACRRBS15400
Человек CEPT1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG12309-ANGRBS15400
Человек CEPT1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG12309-ANRRBS15400
Человек CEPT1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12309-CFRBS13340
Человек CEPT1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12309-CHRBS13340
Человек CEPT1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12309-CMRBS13340
Человек CEPT1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12309-CYRBS13340
Человек CEPT1 Джин клон кДНК в вектор клонированияHG12309-GRBS5130
Человек CEPT1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12309-NFRBS13340
Человек CEPT1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12309-NHRBS13340
Человек CEPT1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12309-NMRBS13340
Человек CEPT1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12309-NYRBS13340
Человек CEPT1 Джин ORF экспрессии кДНК клона плазмидыHG12309-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG12309-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».