CEP57 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Price:
Size:
Number:

CEP57 cDNA ORF Clone, Human, N-DDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
813 bp
Description
Full length Clone DNA of Human centrosomal protein 57kDa with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CEP57 cDNA ORF Clone, Human, N-DDK (Flag®) tag: Alternative Names

MVA2 cDNA ORF Clone, Human; PIG8 cDNA ORF Clone, Human; TSP57 cDNA ORF Clone, Human

CEP57 Background Information

CEP57 is a centrosomal protein and is involved in nucleating and stabilizing microtubules. CEP57 was initially identified as a regulator of centriole overduplication in an RNA interference screen. There is a link between altered microenvironmental signaling cues such as FGF-2 overexpression and mitotic instability and provide a rationale for the therapeutic targeting of the FGF-2/FGFR1/CEP57 axis in prostate cancer. CEP57 is involved in intracellular transport processes, and its overexpression causes mitotic defects as well as abnormal microtubule nucleation and bundling.
Full Name
centrosomal protein 57kDa
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait