Быстрый заказ

Text Size:AAA

Человек CENP-H Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human CENPH Информация о продукте «Клон cDNA»
Размер кДНК:744bp
Описание кДНК:Full length Clone DNA of Homo sapiens centromere protein H with C terminal HA tag.
Синоним гена:CENPH
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек CENP-H Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Человек CENP-H Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14037-ACGRBS15400
Человек CENP-H Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14037-ACRRBS15400
Человек CENP-H Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14037-ANGRBS15400
Человек CENP-H Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14037-ANRRBS15400
Человек CENP-H Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14037-CFRBS13340
Человек CENP-H Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14037-CHRBS13340
Человек CENP-H Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14037-CMRBS13340
Человек CENP-H Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14037-CYRBS13340
Человек CENP-H Джин клон кДНК в вектор клонированияHG14037-GRBS5130
Человек CENP-H Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14037-NFRBS13340
Человек CENP-H Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14037-NHRBS13340
Человек CENP-H Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14037-NMRBS13340
Человек CENP-H Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14037-NYRBS13340
Человек CENP-H Джин ORF экспрессии кДНК клона плазмидыHG14037-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG14037-CY
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.