After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек CEACAM19 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human CEACAM19 Информация о продукте «Клон cDNA»
Размер кДНК:903bp
Описание кДНК:Full length Clone DNA of Homo sapiens carcinoembryonic antigen-related cell adhesion molecule 19 with N terminal Myc tag.
Синоним гена:CEAL1
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек CEACAM19 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек CEACAM19 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG16087-ACGRBS15400
Человек CEACAM19 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG16087-ACRRBS15400
Человек CEACAM19 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG16087-CFRBS13340
Человек CEACAM19 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG16087-CHRBS13340
Человек CEACAM19 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG16087-CMRBS13340
Человек CEACAM19 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG16087-CYRBS13340
Человек CEACAM19 Джин клон кДНК в вектор клонированияHG16087-GRBS5130
Человек CEACAM19 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG16087-NFRBS13340
Человек CEACAM19 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG16087-NHRBS13340
Человек CEACAM19 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG16087-NMRBS13340
Человек CEACAM19 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG16087-NYRBS13340
Человек CEACAM19 Джин ORF экспрессии кДНК клона плазмидыHG16087-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG16087-NM
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.