Быстрый заказ

Человек p27/Kip1/CDKN1B Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек CDKN1B Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_004064.3
    Размер кДНК:597bp
    Описание кДНК:Full length Clone DNA of Homo sapiens cyclin-dependent kinase inhibitor 1B (p27, Kip1) with C terminal His tag.
    Синоним гена:KIP1, MEN4, CDKN4, MEN1B, P27KIP1, CDKN1B
    Виды:Human
    переносчик:pCMV3-C-His
    Plasmid:
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CDKN1B qPCR primers for gene expression analysis, HP101024 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Человек p27/Kip1/CDKN1B Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
    Человек p27/Kip1/CDKN1B Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11109-ACGRBS15400
    Человек p27/Kip1/CDKN1B Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11109-ACRRBS15400
    Человек p27/Kip1/CDKN1B Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG11109-ANGRBS15400
    Человек p27/Kip1/CDKN1B Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG11109-ANRRBS15400
    Человек p27/Kip1/CDKN1B Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11109-CFRBS13340
    Человек p27/Kip1/CDKN1B Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11109-CHRBS13340
    Человек p27/Kip1/CDKN1B Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11109-CMRBS13340
    Человек p27/Kip1/CDKN1B Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11109-CYRBS13340
    Человек p27/Kip1/CDKN1B Джин клон кДНК в вектор клонированияHG11109-MRBS5130
    Человек p27/Kip1/CDKN1B Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11109-NFRBS13340
    Человек p27/Kip1/CDKN1B Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11109-NHRBS13340
    Человек p27/Kip1/CDKN1B Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11109-NMRBS13340
    Человек p27/Kip1/CDKN1B Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11109-NYRBS13340
    Человек p27/Kip1/CDKN1B Джин ORF экспрессии кДНК клона плазмидыHG11109-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: HG11109-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».