Быстрый заказ

Человек p27/Kip1/CDKN1B Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human CDKN1B Информация о продукте «Клон cDNA»
Размер кДНК:597bp
Описание кДНК:Full length Clone DNA of Homo sapiens cyclin-dependent kinase inhibitor 1B (p27, Kip1) with C terminal His tag.
Синоним гена:KIP1, MEN4, CDKN4, MEN1B, P27KIP1, CDKN1B
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек p27/Kip1/CDKN1B Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек p27/Kip1/CDKN1B Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11109-ACGRBS15400
Человек p27/Kip1/CDKN1B Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11109-ACRRBS15400
Человек p27/Kip1/CDKN1B Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG11109-ANGRBS15400
Человек p27/Kip1/CDKN1B Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG11109-ANRRBS15400
Человек p27/Kip1/CDKN1B Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11109-CFRBS13340
Человек p27/Kip1/CDKN1B Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11109-CHRBS13340
Человек p27/Kip1/CDKN1B Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11109-CMRBS13340
Человек p27/Kip1/CDKN1B Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11109-CYRBS13340
Человек p27/Kip1/CDKN1B Джин клон кДНК в вектор клонированияHG11109-MRBS5130
Человек p27/Kip1/CDKN1B Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11109-NFRBS13340
Человек p27/Kip1/CDKN1B Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11109-NHRBS13340
Человек p27/Kip1/CDKN1B Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11109-NMRBS13340
Человек p27/Kip1/CDKN1B Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11109-NYRBS13340
Человек p27/Kip1/CDKN1B Джин ORF экспрессии кДНК клона плазмидыHG11109-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG11109-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.