After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек p21/WAF1/CDKN1A Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human CDKN1A Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_000389.3
Размер кДНК:495bp
Описание кДНК:Full length Clone DNA of Homo sapiens cyclin-dependent kinase inhibitor 1A (p21, Cip1) with C terminal His tag.
Синоним гена:P21, CIP1, SDI1, WAF1, CAP20, CDKN1, MDA-6, p21CIP1, CDKN1A
Виды:Human
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек p21/WAF1/CDKN1A Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек p21/WAF1/CDKN1A Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11108-ACGRBS15400
Человек p21/WAF1/CDKN1A Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11108-ACRRBS15400
Человек p21/WAF1/CDKN1A Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG11108-ANGRBS15400
Человек p21/WAF1/CDKN1A Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG11108-ANRRBS15400
Человек p21/WAF1/CDKN1A Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11108-CFRBS13340
Человек p21/WAF1/CDKN1A Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11108-CHRBS13340
Человек p21/WAF1/CDKN1A Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11108-CMRBS13340
Человек p21/WAF1/CDKN1A Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11108-CYRBS13340
Человек p21/WAF1/CDKN1A Джин клон кДНК в вектор клонированияHG11108-MRBS5130
Человек p21/WAF1/CDKN1A Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11108-NFRBS13340
Человек p21/WAF1/CDKN1A Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11108-NHRBS13340
Человек p21/WAF1/CDKN1A Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11108-NMRBS13340
Человек p21/WAF1/CDKN1A Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11108-NYRBS13340
Человек p21/WAF1/CDKN1A Джин ORF экспрессии кДНК клона плазмидыHG11108-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG11108-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».