After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек CDKL2 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human CDKL2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_003948.3
Размер кДНК:1482bp
Описание кДНК:Full length Clone DNA of Homo sapiens cyclin-dependent kinase-like 2 (CDC2-related kinase).
Синоним гена:P56, KKIAMRE, CDKL2
Виды:Human
переносчик:pCMV3-untagged
Plasmid:pCMV3-CDKL2
Участок рестрикции:HindIII + XbaI (6.1kb + 1.48kb)
Последовательность меток:
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human CDKL2 Gene Plasmid Map
Human CDKL2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Человек CDKL2 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек CDKL2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11191-ACGRBS15400
Человек CDKL2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11191-ACRRBS15400
Человек CDKL2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG11191-ANGRBS15400
Человек CDKL2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG11191-ANRRBS15400
Человек CDKL2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11191-CFRBS13340
Человек CDKL2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11191-CHRBS13340
Человек CDKL2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11191-CMRBS13340
Человек CDKL2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11191-CYRBS13340
Человек CDKL2 Джин клон кДНК в вектор клонированияHG11191-MRBS5130
Человек CDKL2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11191-M-FRBS13340
Человек CDKL2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11191-NFRBS13340
Человек CDKL2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11191-NHRBS13340
Человек CDKL2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11191-NMRBS13340
Человек CDKL2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11191-NYRBS13340
Человек CDKL2 Джин ORF экспрессии кДНК клона плазмидыHG11191-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Cyclin-dependent kinase-like 2 (Cdkl2) is a member of cdc2-related serine / threonine protein kinase family and it is found expressed in various brain regions, including the cerebral cortex, entorinal cortex, hippocampus, amygdala, and dorsal thalamus. The high expression in these brain regions suggests that Cdkl2 may have functions in congnition and emotion processes. Cdkl2 accumulates primarily in the cytoplasm, with lower levels in the nucleus.

Ссылки
  • Sassa T, et al. (2003) Postnatal expression of Cdkl2 in mouse brain revealed by LacZ inserted into the Cdkl2 locus. Cell and Tissue Research. 315 (2): 147-56.
  • Rosenblatt J, et al. (1992) Human cyclin-dependent kinase 2 is activated during the S and G2 phases of the cell cycle and associates with cyclin A. PNAS. 89 (7): 2824-8.
  • Mironov V, et al. (1999) Cyclin-Dependent Kinases and Cell Division in Plants-The Nexus. The Plant Cell. 11 (4): 509-22.
  • Size / Price
    Каталог: HG11191-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
    • Human CDKL2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».