After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек Cadherin-6/CDH6 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human CDH6 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC000019.2
Размер кДНК:1992bp
Описание кДНК:Full length Clone DNA of Homo sapiens cadherin 6, type 2, K-cadherin (fetal kidney) with N terminal Myc tag.
Синоним гена:CDH6, KCAD
Виды:Human
переносчик:pCMV3-SP-N-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек Cadherin-6/CDH6 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек Cadherin-6/CDH6 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10150-ACGRBS16760
Человек Cadherin-6/CDH6 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10150-ACRRBS16760
Человек Cadherin-6/CDH6 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10150-CFRBS14710
Человек Cadherin-6/CDH6 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10150-CHRBS14710
Человек Cadherin-6/CDH6 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10150-CMRBS14710
Человек Cadherin-6/CDH6 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10150-CYRBS14710
Человек Cadherin-6/CDH6 Джин клон кДНК в вектор клонированияHG10150-MRBS5130
Человек Cadherin-6/CDH6 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10150-M-FRBS14710
Человек Cadherin-6/CDH6 Джин ORF экспрессии кДНК клона плазмидыHG10150-M-NRBS14710
Человек Cadherin-6/CDH6 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10150-NFRBS14710
Человек Cadherin-6/CDH6 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10150-NHRBS14710
Человек Cadherin-6/CDH6 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10150-NMRBS14710
Человек Cadherin-6/CDH6 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10150-NYRBS14710
Человек Cadherin-6/CDH6 Джин ORF экспрессии кДНК клона плазмидыHG10150-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Cadherins are a family of calcium-dependent, cell-cell adhesion molecules that play an important morphoregulatory role in a wide variety of tissues. Alterations in cadherin function have been implicated in tumor progression in a number of adenocarcinomas. Cadherin-6 (CDH6), also known as K-cadherin (KCAD), is a type-II classic cadherin cell-cell adhesion molecules, which are expressed in graded or areal patterns, as well as layer-specific patterns, in the cortical plate. Human Cadherin-6 is synthesized as a 790 aa type I transmembrane glycoprotein that contains a 18 aa signal peptide, a 35 aa propeptide, a 562 aa extracellular region, a 21 aa transmembrane segment, and a 154 aa cytoplasmic domain. There are five cadherin domains of approximately 110 aa each in the extracellular region. Cadherin-6 is highly expressed in brain, cerebellum, and kidney, and may contribute to the formation of the segmental structure of the early brain, as well as the development of renal proximal tubules. Weak expression is also detected lung, pancreas, and gastric mucosa. Additionally, it is specifically expressed in the proximal tubule of normal kidneys and in renal cell cancer. Thus , Cadherin-6 is a new prognostic factor for renal cancer.

Ссылки
  • Paul R, et al. (1997) Cadherin-6, a cell adhesion molecule specifically expressed in the proximal renal tubule and renal cell carcinoma. Cancer Res. 57(13): 2741-8.
  • Paul R, et al. (2004) Cadherin-6: a new prognostic marker for renal cell carcinoma. J Urol. 171(1): 97-101.
  • Taniguchi H, et al. (2006) Classic cadherins regulate tangential migration of precerebellar neurons in the caudal hindbrain. Development. 133(10): 1923-31.
  • Liu Q, et al. (2006) cadherin-6 message expression in the nervous system of developing zebrafish. Dev Dyn. 235(1): 272-8.
  • Size / Price
    Каталог: HG10150-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».