After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек CDH13 / Cadherin-13 / H Cadherin Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human CDH13 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001257.3
Размер кДНК:2142bp
Описание кДНК:Full length Clone DNA of Homo sapiens cadherin 13,H-cadherin(heart) with C terminal Myc tag.
Синоним гена:CDHH,
Виды:Human
переносчик:pCMV3-C-Myc
Plasmid:pCMV3-CDH13-Myc
Участок рестрикции:KpnI+XbaI (6kb+2.19kb)
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 2076A/G not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human CDH13 Gene Plasmid Map
Human CDH13 ORF mammalian expression plasmid, C-Myc tag
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек CDH13 / Cadherin-13 / H Cadherin Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Человек CDH13 / Cadherin-13 / H Cadherin Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11249-ACGRBS16760
Человек CDH13 / Cadherin-13 / H Cadherin Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11249-ACRRBS16760
Человек CDH13 / Cadherin-13 / H Cadherin Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11249-CFRBS14710
Человек CDH13 / Cadherin-13 / H Cadherin Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11249-CHRBS14710
Человек CDH13 / Cadherin-13 / H Cadherin Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11249-CMRBS14710
Человек CDH13 / Cadherin-13 / H Cadherin Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11249-CYRBS14710
Человек CDH13 / Cadherin-13 / H Cadherin Джин клон кДНК в вектор клонированияHG11249-MRBS5130
Человек CDH13 / Cadherin-13 / H Cadherin Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11249-NFRBS14710
Человек CDH13 / Cadherin-13 / H Cadherin Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11249-NHRBS14710
Человек CDH13 / Cadherin-13 / H Cadherin Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11249-NMRBS14710
Человек CDH13 / Cadherin-13 / H Cadherin Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11249-NYRBS14710
Человек CDH13 / Cadherin-13 / H Cadherin Джин ORF экспрессии кДНК клона плазмидыHG11249-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

CDH13, also known as cadherin-13 and H Cadherin, is a member of the cadherin superfamily. CDH13 acts as a negative regulator of axon growth during neural differentiation. It also protects vascular endothelial cells from apoptosis due to oxidative stress, and is associated with resistance to atherosclerosis. CDH13 is localized to the surface of the cell membrane and is anchored by a GPI moiety, rather than by a transmembrane domain. CDH13 gene is hypermethylated in many types of cancer.

Ссылки
  • Hart AB. et al., 2012, PLoS One. 7 (8): e42646.
  • Xu J. et al., 2012, BMC Cancer. 12: 243.
  • Jo J. et al., 2012, Obesity (Silver Spring). 20 (8): 1683-7.
  • Size / Price
    Каталог: HG11249-CM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».