After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек CDCA4 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human CDCA4 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC025263
Размер кДНК:726bp
Описание кДНК:Full length Clone DNA of Homo sapiens cell division cycle associated 4 DNA.
Синоним гена:HEPP, SEI-3/HEPP
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек CDCA4 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек CDCA4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15243-ACGRBS15400
Человек CDCA4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15243-ACRRBS15400
Человек CDCA4 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG15243-ANGRBS15400
Человек CDCA4 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG15243-ANRRBS15400
Человек CDCA4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15243-CFRBS13340
Человек CDCA4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15243-CHRBS13340
Человек CDCA4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15243-CMRBS13340
Человек CDCA4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15243-CYRBS13340
Человек CDCA4 Джин клон кДНК в вектор клонированияHG15243-GRBS5130
Человек CDCA4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15243-NFRBS13340
Человек CDCA4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15243-NHRBS13340
Человек CDCA4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15243-NMRBS13340
Человек CDCA4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15243-NYRBS13340
Человек CDCA4 Джин ORF экспрессии кДНК клона плазмидыHG15243-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG15243-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».