Быстрый заказ

Человек CDC26 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human CDC26 Информация о продукте «Клон cDNA»
Размер кДНК:258bp
Описание кДНК:Full length Clone DNA of Homo sapiens cell division cycle 26 with N terminal Flag tag.
Синоним гена:APC12, ANAPC12, C9orf17
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек CDC26 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Человек CDC26 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15142-ACGRBS15400
Человек CDC26 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15142-ACRRBS15400
Человек CDC26 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG15142-ANGRBS15400
Человек CDC26 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG15142-ANRRBS15400
Человек CDC26 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15142-CFRBS13340
Человек CDC26 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15142-CHRBS13340
Человек CDC26 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15142-CMRBS13340
Человек CDC26 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15142-CYRBS13340
Человек CDC26 Джин клон кДНК в вектор клонированияHG15142-GRBS5130
Человек CDC26 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15142-NFRBS13340
Человек CDC26 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15142-NHRBS13340
Человек CDC26 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15142-NMRBS13340
Человек CDC26 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15142-NYRBS13340
Человек CDC26 Джин ORF экспрессии кДНК клона плазмидыHG15142-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG15142-NF
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.