After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек CDC2 Kinase / CDK1 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human CDK1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001786.4
Размер кДНК:894bp
Описание кДНК:Full length Clone DNA of Homo sapiens cell division cycle 2, G1 to S and G2 to M transcript variant 1 with N terminal His tag.
Синоним гена:CDK1, CDC28A, MGC111195, DKFZp686L20222, CDC2
Виды:Human
переносчик:pCMV3-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек CDC2 Kinase / CDK1 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек CDC2 Kinase / CDK1 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10739-ACGRBS15400
Человек CDC2 Kinase / CDK1 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10739-ACRRBS15400
Человек CDC2 Kinase / CDK1 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG10739-ANGRBS15400
Человек CDC2 Kinase / CDK1 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG10739-ANRRBS15400
Человек CDC2 Kinase / CDK1 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10739-CFRBS13340
Человек CDC2 Kinase / CDK1 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10739-CHRBS13340
Человек CDC2 Kinase / CDK1 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10739-CMRBS13340
Человек CDC2 Kinase / CDK1 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10739-CYRBS13340
Человек CDC2 Kinase / CDK1 transcript variant 1 Джин клон кДНК в вектор клонированияHG10739-MRBS5130
Человек CDC2 Kinase / CDK1 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10739-M-FRBS13340
Человек CDC2 Kinase / CDK1 transcript variant 1 Джин ORF экспрессии кДНК клона плазмидыHG10739-M-NRBS13340
Человек CDC2 Kinase / CDK1 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10739-NFRBS13340
Человек CDC2 Kinase / CDK1 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10739-NHRBS13340
Человек CDC2 Kinase / CDK1 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10739-NMRBS13340
Человек CDC2 Kinase / CDK1 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10739-NYRBS13340
Человек CDC2 Kinase / CDK1 transcript variant 1 Джин ORF экспрессии кДНК клона плазмидыHG10739-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

CDC2, also known as CDK1, contains 1 protein kinase domain and belongs to the protein kinase superfamily, CMGC Ser/Thr protein kinase family, CDC2/CDKX subfamily. CDC2 is a catalytic subunit of the highly conserved protein kinase complex known as M-phase promoting factor (MPF), which is essential for G1/S and G2/M phase transitions of eukaryotic cell cycle. Mitotic cyclins stably associate with CDC2 and function as regulatory subunits. The kinase activity of CDK1 is controlled by cyclin accumulation and destruction through the cell cycle. The phosphorylation and dephosphorylation of CDC2 also play important regulatory roles in cell cycle control. It is required in higher cells for entry into S-phase and mitosis. CDC2 also is a cyclin-dependent kinase which displays CTD kinase activity and is required for RNA splicing. It has CTD kinase activity by hyperphosphorylating the C-terminal heptapeptide repeat domain (CTD) of the largest RNA polymerase II subunit RPB1, thereby acting as a key regulator of transcription elongation. CDK1 is required for RNA splicing, possibly by phosphorylating SRSF1/SF2. It is involved in regulation of MAP kinase activity, possibly leading to affect the response to estrogn inhibitors.

Ссылки
  • Lee MG, et al. (1987) Complementation used to clone a human homologue of the fission yeast cell cycle control gene cdc2. Nature. 327(6117):31-5.
  • Enserink JM, et al. (2010) An overview of Cdk1-controlled targets and processes. Cell Division. 5(11): 1-41.
  • Ninomiya-Tsuji J, et al. (1991) Cloning of a human cDNA encoding a CDC2-related kinase by complementation of a budding yeast cdc28 mutation. Proc Natl Acad Sci. 88(20):9006-10.
  • Zhan Q, et al. (1999) Association with Cdc2 and inhibition of Cdc2/Cyclin B1 kinase activity by the p53-regulated protein Gadd45. Oncogene. 18(18):2892-900.
  • Jin S, et al. (2000) The GADD45 inhibition of Cdc2 kinase correlates with GADD45-mediated growth suppression. J Biol Chem. 275(22):16602-8.
  •  

    Size / Price
    Каталог: HG10739-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».