Быстрый заказ

Человек CD99L2 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек CD99L2 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_031462.3
    Размер кДНК:789bp
    Описание кДНК:Full length Clone DNA of Homo sapiens CD99 molecule-like 2 with C terminal His tag.
    Синоним гена:CD99B, MIC2L1
    Виды:Human
    переносчик:pCMV3-C-His
    Plasmid:
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CD99L2 qPCR primers for gene expression analysis, HP104352 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Человек CD99L2 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
    Человек CD99L2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15760-ACGRBS15400
    Человек CD99L2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15760-ACRRBS15400
    Человек CD99L2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15760-CFRBS13340
    Человек CD99L2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15760-CHRBS13340
    Человек CD99L2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15760-CMRBS13340
    Человек CD99L2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15760-CYRBS13340
    Человек CD99L2 Джин клон кДНК в вектор клонированияHG15760-GRBS5130
    Человек CD99L2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15760-NFRBS13340
    Человек CD99L2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15760-NHRBS13340
    Человек CD99L2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15760-NMRBS13340
    Человек CD99L2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15760-NYRBS13340
    Человек CD99L2 Джин ORF экспрессии кДНК клона плазмидыHG15760-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    CD99 antigen-like protein 2, also known as MIC2-like protein 1, CD99L2 and MIC2L1, is a single-pass type I  membrane protein which belongs to the CD99 family. CD99L2 is expressed in brain, heart, lung, liver, spleen, kidney, stomach, small intestine, skeletal muscle, ovary, thymus, testis and uterus. Lower expression of CD99L2 is seen in thymus. It is also expressed in E18 uterus and placenta. CD99 and CD99L2 were required for leukocyte extravasation in the cremaster after stimulation with tumor necrosis factor-alpha, where the need for PECAM-1 is known to be bypassed. CD99 and CD99L2 act independently of PECAM-1 in leukocyte extravasation and cooperate in an independent way to help neutrophils overcome the endothelial basement membrane. CD99L2 may function as a homophilic adhesion molecule. It functions in leukocyte-endothelial cell interactions during leukocyte extravasation, and in particular, at the diapedesis step. CD99L2 does not seem to be involved in docking of leukocytes to the vessel wall or in lymphocyte diapedesis.

    Ссылки
  • Suh, YH. et al., 2003, Gene. 307: 63-76.
  • Park,S.H. Gene 2005, 353 (2):177-88.
  • Schenkel, AR et al., 2007, Cell Commun Adhes. 14 (5):227-37.
  • Bixel, MG. et al., 2010, Blood. 116 (7):1172-84. 
  • Size / Price
    Каталог: HG15760-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».