After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек CD99L2 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human CD99L2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_031462.3
Размер кДНК:789bp
Описание кДНК:Full length Clone DNA of Homo sapiens CD99 molecule-like 2 with C terminal HA tag.
Синоним гена:CD99B, MIC2L1
Виды:Human
переносчик:pCMV3-C-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек CD99L2 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Человек CD99L2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15760-ACGRBS15400
Человек CD99L2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15760-ACRRBS15400
Человек CD99L2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15760-CFRBS13340
Человек CD99L2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15760-CHRBS13340
Человек CD99L2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15760-CMRBS13340
Человек CD99L2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15760-CYRBS13340
Человек CD99L2 Джин клон кДНК в вектор клонированияHG15760-GRBS5130
Человек CD99L2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15760-NFRBS13340
Человек CD99L2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15760-NHRBS13340
Человек CD99L2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15760-NMRBS13340
Человек CD99L2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15760-NYRBS13340
Человек CD99L2 Джин ORF экспрессии кДНК клона плазмидыHG15760-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Mouse CD99 antigen-like protein 2, also known as MIC2-like protein 1, CD99L2 and MIC2L1, is a single-pass type I  membrane protein which belongs to the CD99 family. CD99L2 is expressed in brain, heart, lung, liver, spleen, kidney, stomach, small intestine, skeletal muscle, ovary, thymus, testis and uterus. Lower expression of CD99L2 is seen in thymus. It is also expressed in E18 uterus and placenta. CD99 and CD99L2 were required for leukocyte extravasation in the cremaster after stimulation with tumor necrosis factor-alpha, where the need for PECAM-1 is known to be bypassed. CD99 and CD99L2 act independently of PECAM-1 in leukocyte extravasation and cooperate in an independent way to help neutrophils overcome the endothelial basement membrane. CD99L2 may function as a homophilic adhesion molecule. It functions in leukocyte-endothelial cell interactions during leukocyte extravasation, and in particular, at the diapedesis step. CD99L2 does not seem to be involved in docking of leukocytes to the vessel wall or in lymphocyte diapedesis.

Ссылки
  • Suh, YH. et al., 2003, Gene. 307: 63-76.
  • Park,S.H. Gene 2005, 353 (2):177-88.
  • Schenkel, AR et al., 2007, Cell Commun Adhes. 14 (5):227-37.
  • Bixel, MG. et al., 2010, Blood. 116 (7):1172-84. 
  • Size / Price
    Каталог: HG15760-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».