Быстрый заказ

Человек CD99 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human CD99 Информация о продукте «Клон cDNA»
Размер кДНК:558bp
Описание кДНК:Full length Clone DNA of Homo sapiens CD99 molecule with C terminal Myc tag.
Синоним гена:MIC2, HBA71, MIC2X, MIC2Y, MSK5X, CD99
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек CD99 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Человек CD99 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12193-ACGRBS15400
Человек CD99 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12193-ACRRBS15400
Человек CD99 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12193-CFRBS13340
Человек CD99 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12193-CHRBS13340
Человек CD99 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12193-CMRBS13340
Человек CD99 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12193-CYRBS13340
Человек CD99 Джин клон кДНК в вектор клонированияHG12193-GRBS5130
Человек CD99 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12193-NFRBS13340
Человек CD99 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12193-NHRBS13340
Человек CD99 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12193-NMRBS13340
Человек CD99 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12193-NYRBS13340
Человек CD99 Джин ORF экспрессии кДНК клона плазмидыHG12193-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. CD99 is a transmembrane protein expressed on most hematopoietic cells, endothelial cells and at the borders between confluent cells. CD99 is also found expressed in the development of normal ovary and testis as well as in 25 sex cord-stromal tumors, 7 epithelial neoplasms, and 6 germ cell tumors. CD99 may be a useful marker for sex cord-stromal tumors and that its degree of reactivity correlates with the degree of differentiation in Sertoli-Leydig cell tumors. Additionally, CD99 might aid in distinguishing granulose cell tumors of the ovary from poorly differentiated carcinomas and it has been reported to be a sensitive and specific marker for Ewing's sarcoma and primitive neuroectodermal tumor.

  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • Schenkel AR, et al. (2002) CD99 plays a major role in the migration of monocytes through endothelial junctions. Nature Immunology. 3: 143 - 50.
  • Gordon MD, et al. (1998) CD99, keratin, and vimentin staining of sex cord-stromal tumors, normal ovary, and testis. Mod Pathol. 11 (8): 769-73.
  • Size / Price
    Каталог: HG12193-CM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.