Быстрый заказ

Человек CD84 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек CD84 Информация о продукте «Клон cDNA»
    Размер кДНК:987bp
    Описание кДНК:Full length Clone DNA of Homo sapiens CD84 molecule with N terminal His tag.
    Синоним гена:LY9B, hCD84, mCD84, SLAMF5, DKFZp781E2378
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    ( We provide with CD84 qPCR primers for gene expression analysis, HP100181 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Человек CD84 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
    Человек CD84 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10100-ACGRBS15400
    Человек CD84 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10100-ACRRBS15400
    Человек CD84 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10100-CFRBS13340
    Человек CD84 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10100-CHRBS13340
    Человек CD84 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10100-CMRBS13340
    Человек CD84 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10100-CYRBS13340
    Человек CD84 transcript variant 2 Джин клон кДНК в вектор клонированияHG10100-MRBS5130
    Человек CD84 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10100-M-FRBS13340
    Человек CD84 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10100-NFRBS13340
    Человек CD84 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10100-NHRBS13340
    Человек CD84 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10100-NMRBS13340
    Человек CD84 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10100-NYRBS13340
    Человек CD84 transcript variant 2 Джин ORF экспрессии кДНК клона плазмидыHG10100-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name

    The CD2 family receptors are type I transmembrane glycoproteins belonging to immunoglobulin (Ig) superfamily characterized by a membrane-proximal Ig constant 2 (C2) domain and a membrane-distal variable (V) domain that is responsible for ligand recognition. CD84, also known as LY9B and SLAMF5, is a homophilic member of the SLAM (signaling lymphocyte activation molecule) subfamily of the CD2 family. The SLAM family receptorsmediate signal transduction through the interaction of its ITSM (immunoreceptor tyrosine-based switch motifs) in the intracellular region and the SH2 domain of adaptor molecules SAP (SLAM-associated protein) and EAT-2 (EWS-activated transcript 2), and accordingly modulate both adaptive and innate immune responses. The CD84-CD84 interaction was independent of its cytoplasmic tail. Thus, CD84 is its own ligand and acts as a costimulatory molecule. CD84 is expressed on cells from almost all hematopoietic lineages and on CD34+ hematopoietic progenitor cells, suggesting that CD84 serves as a marker for committed hematopoietic progenitor cells.

  • Martin M, et al. (2001) CD84 functions as a homophilic adhesion molecule and enhances IFN-gamma secretion: adhesion is mediated by Ig-like domain 1. J Immunol. 167(7): 3668-76.
  • Tangye SG, et al. (2002) CD84 is up-regulated on a major population of human memory B cells and recruits the SH2 domain containing proteins SAP and EAT-2. Eur J Immunol. 32(6): 1640-9.
  • Zaiss M, et al. (2003) CD84 expression on human hematopoietic progenitor cells. Exp Hematol. 31(9): 798-805.
  • Tangye SG, et al. (2003) Functional requirements for interactions between CD84 and Src homology 2 domain-containing proteins and their contribution to human T cell activation. J Immunol. 171(5): 2485-95.
  • Yan Q, et al. (2007) Structure of CD84 provides insight into SLAM family function. Proc Natl Acad Sci U S A. 104(25): 10583-8.
  • Size / Price
    Каталог: HG10100-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.