After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек CD84 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human CD84 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_003874.1
Размер кДНК:987bp
Описание кДНК:Full length Clone DNA of Homo sapiens CD84 molecule with N terminal His tag.
Синоним гена:LY9B, hCD84, mCD84, SLAMF5, DKFZp781E2378
Виды:Human
переносчик:pCMV3-SP-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек CD84 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек CD84 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10100-ACGRBS15400
Человек CD84 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10100-ACRRBS15400
Человек CD84 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10100-CFRBS13340
Человек CD84 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10100-CHRBS13340
Человек CD84 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10100-CMRBS13340
Человек CD84 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10100-CYRBS13340
Человек CD84 transcript variant 2 Джин клон кДНК в вектор клонированияHG10100-MRBS5130
Человек CD84 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10100-M-FRBS13340
Человек CD84 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10100-NFRBS13340
Человек CD84 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10100-NHRBS13340
Человек CD84 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10100-NMRBS13340
Человек CD84 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10100-NYRBS13340
Человек CD84 transcript variant 2 Джин ORF экспрессии кДНК клона плазмидыHG10100-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

The CD2 family receptors are type I transmembrane glycoproteins belonging to immunoglobulin (Ig) superfamily characterized by a membrane-proximal Ig constant 2 (C2) domain and a membrane-distal variable (V) domain that is responsible for ligand recognition. CD84, also known as LY9B and SLAMF5, is a homophilic member of the SLAM (signaling lymphocyte activation molecule) subfamily of the CD2 family. The SLAM family receptorsmediate signal transduction through the interaction of its ITSM (immunoreceptor tyrosine-based switch motifs) in the intracellular region and the SH2 domain of adaptor molecules SAP (SLAM-associated protein) and EAT-2 (EWS-activated transcript 2), and accordingly modulate both adaptive and innate immune responses. The CD84-CD84 interaction was independent of its cytoplasmic tail. Thus, CD84 is its own ligand and acts as a costimulatory molecule. CD84 is expressed on cells from almost all hematopoietic lineages and on CD34+ hematopoietic progenitor cells, suggesting that CD84 serves as a marker for committed hematopoietic progenitor cells.

Ссылки
  • Martin M, et al. (2001) CD84 functions as a homophilic adhesion molecule and enhances IFN-gamma secretion: adhesion is mediated by Ig-like domain 1. J Immunol. 167(7): 3668-76.
  • Tangye SG, et al. (2002) CD84 is up-regulated on a major population of human memory B cells and recruits the SH2 domain containing proteins SAP and EAT-2. Eur J Immunol. 32(6): 1640-9.
  • Zaiss M, et al. (2003) CD84 expression on human hematopoietic progenitor cells. Exp Hematol. 31(9): 798-805.
  • Tangye SG, et al. (2003) Functional requirements for interactions between CD84 and Src homology 2 domain-containing proteins and their contribution to human T cell activation. J Immunol. 171(5): 2485-95.
  • Yan Q, et al. (2007) Structure of CD84 provides insight into SLAM family function. Proc Natl Acad Sci U S A. 104(25): 10583-8.
  • Size / Price
    Каталог: HG10100-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».