After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек CD81/TAPA1 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human CD81 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC002978
Размер кДНК:711bp
Описание кДНК:Full length Clone DNA of Homo sapiens CD81 molecule.
Синоним гена:CVID6, S5.7, TAPA1, TSPAN28, CD81
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек CD81/TAPA1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек CD81/TAPA1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14244-ACGRBS15400
Человек CD81/TAPA1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14244-ACRRBS15400
Человек CD81/TAPA1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14244-CFRBS13340
Человек CD81/TAPA1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14244-CHRBS13340
Человек CD81/TAPA1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14244-CMRBS13340
Человек CD81/TAPA1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14244-CYRBS13340
Человек CD81/TAPA1 Джин клон кДНК в вектор клонированияHG14244-GRBS5130
Человек CD81/TAPA1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14244-NFRBS13340
Человек CD81/TAPA1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14244-NHRBS13340
Человек CD81/TAPA1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14244-NMRBS13340
Человек CD81/TAPA1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14244-NYRBS13340
Человек CD81/TAPA1 Джин ORF экспрессии кДНК клона плазмидыHG14244-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

CD81, also known as TAPA-1, belongs to the transmembrane 4 superfamily, also known as the tetraspanin family. Members of this family mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility.CD81 is a widely expressed cell-surface protein involved in an astonishing variety of biologic responses. It is related to adhesion, morphology, activation, proliferation, and differentiation of B, T, and other cells. On B cells CD81 is part of a complex with CD21, CD19, and Leu13. This complex reduces the threshold for B cell activation via the B cell receptor by bridging Ag specific recognition and CD21-mediated complement recognition.

Ссылки
  • Petracca R. et al., 2000, J Virol. 74 (10): 4824-30.
  • Bartosch B. et al., 2003, The Journal of Biological Chemistry. 278 (43): 41624-30.
  • Clark KL. et al., 2001, Journal of Immunology. 167 (9): 5115-21.
  • Size / Price
    Каталог: HG14244-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».