After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек CD69 / CLEC2C Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human CD69 Информация о продукте «Клон cDNA»
Размер кДНК:600bp
Описание кДНК:Full length Clone DNA of Homo sapiens CD69 molecule with C terminal HA tag.
Синоним гена:CLEC2C, CD69
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек CD69 / CLEC2C Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Человек CD69 / CLEC2C Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11150-ACGRBS15400
Человек CD69 / CLEC2C Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11150-ACRRBS15400
Человек CD69 / CLEC2C Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11150-CFRBS13340
Человек CD69 / CLEC2C Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11150-CHRBS13340
Человек CD69 / CLEC2C Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11150-CMRBS13340
Человек CD69 / CLEC2C Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11150-CYRBS13340
Человек CD69 / CLEC2C Джин клон кДНК в вектор клонированияHG11150-MRBS5130
Человек CD69 / CLEC2C Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11150-M-FRBS13340
Человек CD69 / CLEC2C Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11150-NFRBS13340
Человек CD69 / CLEC2C Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11150-NHRBS13340
Человек CD69 / CLEC2C Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11150-NMRBS13340
Человек CD69 / CLEC2C Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11150-NYRBS13340
Человек CD69 / CLEC2C Джин ORF экспрессии кДНК клона плазмидыHG11150-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Early activation antigen CD69, also known as activation inducer molecule (AIM), is a single-pass type II membrane protein. Recently, cDNA clones encoding human and mouse CD69 were isolated and showed CD69 to be a member of the C-type lectin superfamily. It is one of the earliest cell surface antigens expressed by T cells following activation. Once expressed, CD69 acts as a costimulatory molecule for T cell activation and proliferation. In addition to mature T cells, CD69 is inducibly expressed by immature thymocytes, B cells, natural killer (NK) cells, monocytes, neutrophils and eosinophils, and is constitutively expressed by mature thymocytes and platelets. CD69 is involved in lymphocyte proliferation and functions as a signal transmitting receptor in lymphocytes, natural killer (NK) cells, and platelets. The structure, chromosomal localization, expression and function of CD69 suggest that it is likely a pleiotropic immune regulator , potentially important in the activation and differentiation of a wide variety of hematopoietic cells. This membrane molecule transiently expresses on activated lymphocytes, and its selective expression in inflammatory infiltrates suggests that it plays a role in the pathogenesis of inflammatory diseases. CD69 plays a crucial role in the pathogenesis of allergen-induced eosinophilic airway inflammation and hyperresponsiveness and that CD69 could be a possible therapeutic target for asthmatic patients.

  • Ziegler SF, et al. (1994) The activation antigen CD69. Stem Cells. 12(5): 456-65.
  • Marzio R, et al. (1999) CD69 and regulation of the immune function. Immunopharmacol Immunotoxicol. 21(3): 565-82.
  • Lamana A, et al. (2006) The role of CD69 in acute neutrophil-mediated inflammation. Eur J Immunol. 36(10): 2632-8.
  • Miki-Hosokawa T, et al. (2009) CD69 controls the pathogenesis of allergic airway inflammation. J Immunol. 183(12): 8203-15.
  • Size / Price
    Каталог: HG11150-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.