After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек CD68 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human CD68 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001251.2
Размер кДНК:1065bp
Описание кДНК:Full length Clone DNA of Homo sapiens CD68 molecule, transcript variant 1.
Синоним гена:GP110, SCARD1, DKFZp686M18236, CD68
Виды:Human
переносчик:pCMV3-untagged
Plasmid:pCMV3-CD68
Участок рестрикции:KpnI + XbaI (6.1kb + 1.07kb)
Последовательность меток:
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human CD68 Gene Plasmid Map
Human CD68 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Человек CD68 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек CD68 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11192-ACGRBS15400
Человек CD68 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11192-ACRRBS15400
Человек CD68 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11192-CFRBS13340
Человек CD68 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11192-CHRBS13340
Человек CD68 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11192-CMRBS13340
Человек CD68 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11192-CYRBS13340
Человек CD68 transcript variant 1 Джин клон кДНК в вектор клонированияHG11192-MRBS5130
Человек CD68 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11192-M-FRBS13340
Человек CD68 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11192-NFRBS13340
Человек CD68 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11192-NHRBS13340
Человек CD68 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11192-NMRBS13340
Человек CD68 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11192-NYRBS13340
Человек CD68 transcript variant 1 Джин ORF экспрессии кДНК клона плазмидыHG11192-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Macrosialin, also known as CD68 and Gp110, is a single-pass type I  membrane protein which belongs to the LAMP family. CD68 is highly expressed by blood monocytes and tissue macrophages. It is also expressed in lymphocytes, fibroblasts and endothelial cells. CD68 is expressed in many tumor cell lines which could allow them to attach to selectins on vascular endothelium, facilitating their dissemination to secondary sites. CD68 plays a role in phagocytic activities of tissue macrophages, both in intracellular lysosomal metabolism and extracellular cell-cell and cell-pathogen interactions. It is a commonly used marker for macrophages. However, a number of studies have shown that CD68 antibodies react with other hematopoietic and non-hematopoietic cell types, suggesting that CD68 may not be a macrophage-specific antigen. CD68 binds to tissue- and organ-specific lectins or selectins, allowing homing of macrophage subsets to particular sites. Rapid recirculation of CD68 from endosomes and lysosomes to the plasma membrane may allow macrophages to crawl over selectin-bearing substrates or other cells.

Ссылки
  • Strobl H. et al., 1995, Br J Haematol. 90 (4): 774-82.
  • Ogawa Y. et al., 1995, Pathol Int. 45 (9): 698-701.
  • Sadovnikova E. et al., 2002,Leukemia. 16 (10): 2019-26.
  • Gottfried E. et al., 2008, Scand J Immunol. 67 (5): 453-63.
  • Strojnik T. et al., 2009, Anticancer Res. 29 (8): 3269-79.
  • Size / Price
    Каталог: HG11192-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».