Быстрый заказ

Text Size:AAA

Человек E-Selectin/CD62e/SELE Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human SELE Информация о продукте «Клон cDNA»
Размер кДНК:1833bp
Описание кДНК:Full length Clone DNA of Homo sapiens selectin E with C terminal Flag tag.
Синоним гена:ELAM, ESEL, CD62E, ELAM1, LECAM2
Участок рестрикции:KpnI + XbaI (6kb + 1.88kb)
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human SELE Gene Plasmid Map
Human CD62E / E-Selectin Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged
Human SELE Gene Expression validated Image
Human CD62E / E-Selectin ORF mammalian expression plasmid, C-Flag tag
[Щелкните, чтобы увеличить изображение]
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек E-Selectin/CD62e/SELE Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Человек E-Selectin/CD62e/SELE Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10335-ACGRBS16764
Человек E-Selectin/CD62e/SELE Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10335-ACRRBS16764
Человек E-Selectin/CD62e/SELE Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10335-CFRBS14711
Человек E-Selectin/CD62e/SELE Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10335-CHRBS14711
Человек E-Selectin/CD62e/SELE Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10335-CMRBS14711
Человек E-Selectin/CD62e/SELE Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10335-CYRBS14711
Человек E-Selectin/CD62e/SELE Джин клон кДНК в вектор клонированияHG10335-MRBS5132
Человек E-Selectin/CD62e/SELE Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10335-NFRBS14711
Человек E-Selectin/CD62e/SELE Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10335-NHRBS14711
Человек E-Selectin/CD62e/SELE Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10335-NMRBS14711
Человек E-Selectin/CD62e/SELE Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10335-NYRBS14711
Человек E-Selectin/CD62e/SELE Джин ORF экспрессии кДНК клона плазмидыHG10335-UTRBS14711
 Узнайте больше о векторов экспрессии,
Product nameProduct name

E-selectin, also known as endothelial leukocyte adhesion molecule-1 (ELAM-1) and CD62E, is an inducible adhesion molecule that is expressed on the surfaces of stimulated vascular endothelial cells and is sometimes involved in cancer cell metastasis. E-selectin exhibits a complex mosaic structure consisting of a large extracellular region comprised of a lectin domain, an EGF-like domain, and a short consensus repeat (SCR) domain, followed by a transmembrane region and a relatively short (32 aa) cytoplasmic tail. As a member of the LEC-CAM or selectin family, E-selectin recognises and binds to sialylated carbohydrates including members of the Lewis X and Lewis A families found on monocytes, granulocytes, and T-lymphocytes. E-selectin supports rolling and stable arrest of leukocytes on activated vascular endothelium, and furthermore, it was indicated that it can also transduce an activating stimulus via the MAPK cascade into the endothelial cell during leukocyte adhesion. E-selectin regulates adhesive interactions between certain blood cells and endothelium. The soluble form of E selectin (sE-selectin) is a marker of endothelial activation, and has a potential role in the pathogenesis of cardiovascular disease as raised levels have been found in hypertension, diabetes and hyperlipidemia, although its association in established atherosclerosis disease and its value as a prognostic factor is more controversial. soluble E-selectin is inversely associated with the muscular component of the left ventricle, thereby suggesting that the lack of such a reparative factor may be associated with cardiac remodeling in end-stage renal disease (ESRD) patients. In addition, this adhesion molecule appears to be involved in the pathogenesis of atherosclerosis.

  • Roldn V, et al. (2003) Soluble E-selectin in cardiovascular disease and its risk factors. A review of the literature. Thromb Haemost. 90(6): 1007-20.
  • Kawase J, et al. (2009) Increase in E-selectin expression in umbilical vein endothelial cells by anticancer drugs and inhibition by cimetidine. Oncol Rep. 22(6): 1293-7.
  • Matsumoto K, et al. (2010) Soluble adhesion molecule E-selectin predicts cardiovascular events in Japanese patients with type 2 diabetes mellitus. Metabolism. 59(3): 320-4.
  • Stancanelli B, et al. (2010) Soluble e-selectin is an inverse and independent predictor of left ventricular wall thickness in end-stage renal disease patients. Nephron Clin Pract. 114(1): c74-80.
  • Size / Price
    Каталог: HG10335-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    • Human CD62E / E-Selectin ORF mammalian expression plasmid, C-Flag tag
    • Human CD62E / E-Selectin Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.