Быстрый заказ

Человек CD5L Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human CD5L Информация о продукте «Клон cDNA»
Размер кДНК:1044bp
Описание кДНК:Full length Clone DNA of Homo sapiens CD5 molecule-like with N terminal Myc tag.
Синоним гена:AIM, API6, PRO229, Spalpha, SP-ALPHA
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек CD5L Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек CD5L Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10791-ACGRBS15400
Человек CD5L Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10791-ACRRBS15400
Человек CD5L Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10791-CFRBS13340
Человек CD5L Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10791-CHRBS13340
Человек CD5L Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10791-CMRBS13340
Человек CD5L Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10791-CYRBS13340
Человек CD5L Джин клон кДНК в вектор клонированияHG10791-MRBS5130
Человек CD5L Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10791-M-FRBS13340
Человек CD5L Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10791-NFRBS13340
Человек CD5L Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10791-NHRBS13340
Человек CD5L Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10791-NMRBS13340
Человек CD5L Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10791-NYRBS13340
Человек CD5L Джин ORF экспрессии кДНК клона плазмидыHG10791-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

CD5L, also known as CD5 antigen-like, is a soluble protein belonging to group B of the scavenger receptor cysteine-rich (SRCR) superfamily and contains three SRCR domains. It is a secreted glycoprotein and expressed by macrophages presentin lymphoid tissues (spleen, lymph node, thymus, and bone marrow). It binds to myelomonocytic and lymphoid cells and may play an important role in the regulation of the innate and adaptive immune systems. CD5L functions as a pattern recognition molecule by binding both lipoteichoic acid (LTA) on Gram positive and lipopolysaccharide (LPS) on Gram negative bacteria. and the SRCR domain 1 of CD5L retains both the LPS and LTA binding activities. In addtion, it is revealed that CD5L seems to play a role as an inhibitor of apoptosis.

  • Resnick, D. et al., 1994, Trends Biochem. Sci. 19: 5-8.
  • Gebe, J. A. et al., 1997, J. Biol. Chem. 272 (10): 6151–6158.
  • Sarrias, M.R. et al., 2004, Crit. Rev. Immunol. 24: 1-37.
  • Mukhopadhyay, S. and Gordon, S., 2004, Immunobiology 209: 39-49.
  • Sarrias, M. R. et al.,2005, J. Biol. Chem. 280 (42): 35391–35398.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.