After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек ICAM-3 / CD50 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human ICAM3 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_002162.3
Размер кДНК:1644bp
Описание кДНК:Full length Clone DNA of Homo sapiens intercellular adhesion molecule 3 with C terminal Flag tag.
Синоним гена:CD50, CDW50, ICAM-R
Виды:Human
переносчик:pCMV3-C-FLAG
Plasmid:pCMV3-ICAM3-Flag
Участок рестрикции:HindIII + XbaI (6kb + 1.68kb)
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human ICAM3 Gene Plasmid Map
Human CD50 / ICAM3 natural ORF mammalian expression plasmid, C-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек ICAM-3 / CD50 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Человек ICAM-3 / CD50 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10333-ACGRBS16760
Человек ICAM-3 / CD50 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10333-ACRRBS16760
Человек ICAM-3 / CD50 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10333-CFRBS14710
Человек ICAM-3 / CD50 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10333-CHRBS14710
Человек ICAM-3 / CD50 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10333-CMRBS14710
Человек ICAM-3 / CD50 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10333-CYRBS14710
Человек ICAM-3 / CD50 Джин клон кДНК в вектор клонированияHG10333-MRBS5130
Человек ICAM-3 / CD50 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10333-NFRBS14710
Человек ICAM-3 / CD50 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10333-NHRBS14710
Человек ICAM-3 / CD50 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10333-NMRBS14710
Человек ICAM-3 / CD50 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10333-NYRBS14710
Человек ICAM-3 / CD50 Джин ORF экспрессии кДНК клона плазмидыHG10333-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

The protein ICAM-3, also known as CD50, is a member of the intercellular adhesion molecule (ICAM) family consisting three members. It is a DC-SIGN ligand that is constitutively expressed on resting leukocytes, and is thus an important molecule for the first immune response. ICAM-3 comprises of five immunoglobulin-like domains, and binds LFA-1 through its two N-terminal domains. It functions not only as an adhesion molecule, but also as a potent signalling molecule. ICAM-3 binds to LFA-1 on antigen-presenting cells (APC) stabilizing the T cell-APC interaction, facilitating signaling through the CD3/TCR complex. However, recent evidence using cultured and transformed T cells suggests ICAM-3 may also function in signaling. It has been reported that CD50 molecule can play a role in developing functionally mature T lymphocytes and its expression increases during the maturation process of T lymphocytes. In addition, the interactions of ICAM-3 and LFA-1 facilitate HIV-1- induced virological synapse formation between T cells. ICAM-3 is associated with an increase of cellular radio-resistance and cancer cell proliferation. It could be considered as a candidate for anti-cancer drug development and as a cancer diagnostic marker.

Ссылки
  • Berney SM, et al. (1999) ICAM-3 (CD50) cross-linking augments signaling in CD3-activated peripheral human T lymphocytes. J Leukoc Biol. 65(6): 867-74.
  • van Buul JD, et al. (2004) ICAM-3 activation modulates cell-cell contacts of human bone marrow endothelial cells. J Vasc Res. 41(1): 28-37.
  • Sugino H. (2005) ICAM-3, a ligand for DC-SIGN, was duplicated from ICAM-1 in mammalian evolution, but was lost in the rodent genome. FEBS Lett. 579(13): 2901-6.
  • Park JK, et al. (2010) ICAM-3 enhances the migratory and invasive potential of human non-small cell lung cancer cells by inducing MMP-2 and MMP-9 via Akt and CREB. Int J Oncol. 36(1): 181-92.
  • Size / Price
    Каталог: HG10333-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
    • Human CD50 / ICAM3 natural ORF mammalian expression plasmid, C-Flag tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».