Быстрый заказ

Человек CD45/PTPRC transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human PTPRC Информация о продукте «Клон cDNA»
Размер кДНК:3432bp
Описание кДНК:Full length Clone DNA of Homo sapiens protein tyrosine phosphatase, receptor type C, transcript variant 2 with N terminal His tag.
Синоним гена:RTPRC, LCA, LY5, B220, CD45, T200, CD45R, GP180
Участок рестрикции:KpnI + XbaI (6kb + 3.48kb)
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human PTPRC Gene Plasmid Map
Human CD45 transcript variant 2 natural ORF mammalian expression plasmid, N-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек CD45/PTPRC transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек CD45/PTPRC transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10086-ACGRBS22240
Человек CD45/PTPRC transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10086-ACRRBS22240
Человек CD45/PTPRC transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10086-CFRBS20190
Человек CD45/PTPRC transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10086-CHRBS20190
Человек CD45/PTPRC transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10086-CMRBS20190
Человек CD45/PTPRC transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10086-CYRBS20190
Человек CD45/PTPRC transcript variant 2 Джин клон кДНК в вектор клонированияHG10086-MRBS5130
Человек CD45/PTPRC transcript variant 2 Джин ORF экспрессии кДНК клона плазмидыHG10086-M-NRBS20190
Человек CD45/PTPRC transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10086-NFRBS20190
Человек CD45/PTPRC transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10086-NHRBS20190
Человек CD45/PTPRC transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10086-NMRBS20190
Человек CD45/PTPRC transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10086-NYRBS20190
Человек CD45/PTPRC transcript variant 2 Джин ORF экспрессии кДНК клона плазмидыHG10086-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. Protein tyrosine phosphatase, receptor type C (CD45), also known as PTPRC is a member of the protein tyrosine phosphatase (PTP) family which is known for its function to serve as signaling molecules and to regulate a variety of cellular processes such as cell proliferation, differentiation, mitotic cycle and oncogenic transformation. CD45 is found expression specifically in hemotopietic cells. CD45 consists of an extracellular domain, a single transmembrane segment and two tandem intracytoplasmic catalytic domains. It serves as an essential regulator of T-cell and B-cell antigen receptor signaling through either direct interaction with components of the antigen receptor complexs or by activating various Src family kinases required for the antigen receptor signaling and it also can suppress JAK kinases.

  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • Irie-Sasaki J, et al. (2001) CD45 is a JAK phosphatase and negatively regulates cytokine receptor signaling. Nature. 409: 349-54.
  • Size / Price
    Каталог: HG10086-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    • Human CD45 transcript variant 2 natural ORF mammalian expression plasmid, N-His tag
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.