Быстрый заказ

Text Size:AAA

Человек CD3e/CD3 epsilon Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human CD3E Информация о продукте «Клон cDNA»
Размер кДНК:624bp
Описание кДНК:Full length Clone DNA of Homo sapiens CD3e molecule, epsilon (CD3-TCR complex) with C terminal Flag tag.
Синоним гена:T3E, TCRE, FLJ18683
Участок рестрикции:KpnI + XbaI (6kb + 0.66kb)
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human CD3E Gene Plasmid Map
Human CD3E natural ORF mammalian expression plasmid, C-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек CD3e/CD3 epsilon Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Человек CD3e/CD3 epsilon Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10977-ACGRBS15400
Человек CD3e/CD3 epsilon Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10977-ACRRBS15400
Человек CD3e/CD3 epsilon Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10977-CFRBS13340
Человек CD3e/CD3 epsilon Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10977-CHRBS13340
Человек CD3e/CD3 epsilon Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10977-CMRBS13340
Человек CD3e/CD3 epsilon Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10977-CYRBS13340
Человек CD3e/CD3 epsilon Джин клон кДНК в вектор клонированияHG10977-MRBS5130
Человек CD3e/CD3 epsilon Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10977-NFRBS13340
Человек CD3e/CD3 epsilon Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10977-NHRBS13340
Человек CD3e/CD3 epsilon Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10977-NMRBS13340
Человек CD3e/CD3 epsilon Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10977-NYRBS13340
Человек CD3e/CD3 epsilon Джин ORF экспрессии кДНК клона плазмидыHG10977-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

T-cell surface glycoprotein CD3 epsilon chain, also known as CD3E, is a single-pass type I membrane protein. CD3E contains 1 Ig-like (immunoglobulin-like) domain and 1 ITAM domain. CD3E, together with CD3-gamma, CD3-delta and CD3-zeta, and the T-cell receptor alpha/beta and gamma/delta heterodimers, forms the T cell receptor-CD3 complex. The CD3 epsilon subunit of the T cell receptor (TCR) complex contains two defined signaling domains, a proline-rich sequence and an immune tyrosine activation motifs (ITAMs), and this complex undergoes a conformational change upon ligand binding that is thought to be important for the activation of T cells. In the CD3 epsilon mutant mice, all stages of T cell development and activation that are TCR-dependent were impaired, but not eliminated, including activation of mature naïve T cells with the MHCII presented superantigen, staphylococcal enterotoxin B, or with a strong TCR cross-linking antibody specific for either TCR-Cbeta or CD3 epsilon. T cell receptor-CD3 complex plays an important role in coupling antigen recognition to several intracellular signal-transduction pathways. This complex is critical for T-cell development and function, and represents one of the most complex transmembrane receptors. CD3E plays an essential role in T-cell development, and defects in CD3E gene cause severe immunodeficiency. Homozygous mutations in CD3D and CD3E genes lead to a complete block in T-cell development and thus to an early-onset severe combined immunodeficiency phenotype.

  • Fischer A, et al. (2005) CD3 deficiencies. Curr Opin Allergy Clin Immunol. 5(6): 491-5.
  • Wang Y, et al. (2009) A conserved CXXC motif in CD3epsilon is critical for T cell development and TCR signaling. PLoS Biol. 7(12): e1000253.
  • Martnez-Martn N, et al. (2009) Cooperativity between T cell receptor complexes revealed by conformational mutants of CD3epsilon. Sci Signal. 2(83): ra43.
  • Deford-Watts LM, et al. (2009) The cytoplasmic tail of the T cell receptor CD3 epsilon subunit contains a phospholipid-binding motif that regulates T cell functions. J Immunol. 183(2): 1055-64.
  • Size / Price
    Каталог: HG10977-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    • Human IFNG ORF mammalian expression plasmid, C-Flag tag
    • Human CD3E natural ORF mammalian expression plasmid, C-Flag tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.