After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек CD3d/CD3 delta Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human CD3D Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_000732.4
Размер кДНК:516bp
Описание кДНК:Full length Clone DNA of Homo sapiens CD3d molecule, delta (CD3-TCR complex) with C terminal Flag tag.
Синоним гена:T3D, CD3-DELTA
Виды:Human
переносчик:pCMV3-C-FLAG
Plasmid:pCMV3-CD3D-Flag
Участок рестрикции:KpnI + XbaI (6kb + 0.56kb)
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human CD3D Gene Plasmid Map
Human CD3D natural ORF mammalian expression plasmid, C-Flag tag
Human CD3D Gene Expression validated Image
Human CD3D ORF mammalian expression plasmid, C-Flag tag
[Щелкните, чтобы увеличить изображение]
Caption:
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек CD3d/CD3 delta Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Человек CD3d/CD3 delta Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10981-ACGRBS15400
Человек CD3d/CD3 delta Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10981-ACRRBS15400
Человек CD3d/CD3 delta Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10981-CFRBS13340
Человек CD3d/CD3 delta Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10981-CHRBS13340
Человек CD3d/CD3 delta Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10981-CMRBS13340
Человек CD3d/CD3 delta Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10981-CYRBS13340
Человек CD3d/CD3 delta Джин клон кДНК в вектор клонированияHG10981-MRBS5130
Человек CD3d/CD3 delta Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10981-NFRBS13340
Человек CD3d/CD3 delta Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10981-NHRBS13340
Человек CD3d/CD3 delta Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10981-NMRBS13340
Человек CD3d/CD3 delta Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10981-NYRBS13340
Человек CD3d/CD3 delta Джин ORF экспрессии кДНК клона плазмидыHG10981-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

T-cell surface glycoprotein CD3 delta chain, also known as CD3D, is a single-pass type I membrane protein. CD3D, together with CD3-gamma, CD3-epsilon and CD3-zeta, and the T-cell receptor alpha/beta and gamma/delta heterodimers, forms the T cell receptor-CD3 complex. The majority of T cell receptor (TCR) complexes in mice and humans consist of a heterodimer of polymorphic TCRalpha and beta chains along with invariant CD3gamma, delta, epsilon, and zeta chains. CD3 chains are present as CD3gammaepsilon, deltaepsilon, and zetazeta dimers in the receptor complex and play critical roles in the antigen receptor assembly, transport to the cell surface, and the receptor-mediated signal transduction. T cell receptor-CD3 complex plays an important role in coupling antigen recognition to several intracellular signal-transduction pathways. This complex is critical for T-cell development and function, and represents one of the most complex transmembrane receptors. The T cell receptor-CD3 complex is unique in having ten cytoplasmic immunoreceptor tyrosine-based activation motifs (ITAMs). CD3D contains 1 ITAM domain and has been shown to interact with CD8A. In the mouse, knockout of CD3delta allows some degree of T lymphocyte differentiation since mature CD4 and CD8 as well as TCRgammadelta T lymphocytes are observed in the periphery. In contrast, deleterious mutation of the CD3delta encoding gene in the human leads to a severe combined immunodeficiency characterised by the complete absence of mature T cell subpopulations including TCRalpha/beta and TCRgamma/delta. Defects in CD3D cause severe combined immunodeficiency autosomal recessive T-cell-negative/B-cell-positive/NK-cell-positive (T-/B+/NK+ SCID) which is a genetically and clinically heterogeneous group of rare congenital disorders characterized by impairment of both humoral and cell-mediated immunity, leukopenia, and low or absent antibody levels. In humans the absence of CD3 delta results in a complete arrest in thymocyte development at the stage of double negative to double positive transition and the development of gamma delta T-cell receptor-positive T cells is also impaired.

Ссылки
  • Roifman CM. (2004) CD3 delta immunodeficiency. Curr Opin Allergy Clin Immunol. 4(6): 479-84.
  • Pan Q, et al. (2006) Different role for mouse and human CD3delta/epsilon heterodimer in preT cell receptor (preTCR) function: human CD3delta/epsilon heterodimer restores the defective preTCR function in CD3gamma- and CD3gammadelta-deficient mice. Mol Immunol. 43(11): 1741-50.
  • Le Deist F, et al. (2007) Expression anomalies of the CD3-TCR complex expression and immunodeficiencies. Med Sci (Paris). 23(2): 161-6.
  • Size / Price
    Каталог: HG10981-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
    • Human CD3D ORF mammalian expression plasmid, C-Flag tag
    • Human CD3D natural ORF mammalian expression plasmid, C-Flag tag
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».