After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек CD36/SCARB3 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human CD36 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001001547.2
Размер кДНК:1419bp
Описание кДНК:Full length Clone DNA of Homo sapiens CD36 molecule (thrombospondin receptor) with N terminal His tag.
Синоним гена:FAT, GP4, GP3B, GPIV, CHDS7, PASIV, SCARB3, CD36
Виды:Human
переносчик:pCMV3-SP-N-His
Plasmid:pCMV3-His-CD36
Участок рестрикции:KpnI + XbaI (6kb + 1.51kb)
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 1416C/T not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human CD36 Gene Plasmid Map
Human CD36 / SCARB3 ORF mammalian expression plasmid, N-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек CD36/SCARB3 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек CD36/SCARB3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10752-ACGRBS15400
Человек CD36/SCARB3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10752-ACRRBS15400
Человек CD36/SCARB3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10752-CFRBS13340
Человек CD36/SCARB3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10752-CHRBS13340
Человек CD36/SCARB3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10752-CMRBS13340
Человек CD36/SCARB3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10752-CYRBS13340
Человек CD36/SCARB3 Джин клон кДНК в вектор клонированияHG10752-MRBS5130
Человек CD36/SCARB3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10752-NFRBS13340
Человек CD36/SCARB3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10752-NHRBS13340
Человек CD36/SCARB3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10752-NMRBS13340
Человек CD36/SCARB3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10752-NYRBS13340
Человек CD36/SCARB3 Джин ORF экспрессии кДНК клона плазмидыHG10752-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. Cluster of differentiation 36 (CD36), also known as FAT, SCARB3, GP88, glycoprotein IV (gpIV) and glycoprotein IIIb (gpIIIb), is a member of the CD system as well as the class B scavenger receptor family of cell surface proteins. CD36 can be found on the surface of many cell types in vertebrate animals and it consists of 472 amino acids and is extensively glycosylated. It is an integral membrane protein primarily serving as receptors for thrombospondin and collagen and by the erythrocytes infected with the human malaria parasite. The role of CD36 as a cell surface receptor has been extended to that of a signal transduction molecule.

Ссылки
  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • Greenwalt RH, et al. (1992) Membrane glycoprotein in CD36: a review of its roles in adherence, signal transduction, and transfusion medicine. The journal of the American society of hematology. 80 (5): 1105-15.
  • Size / Price
    Каталог: HG10752-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».