After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек CD34 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human CD34 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001773.2
Размер кДНК:987bp
Описание кДНК:Full length Clone DNA of Homo sapiens CD34 molecule, transcript variant 2 with N terminal His tag.
Синоним гена:CD34
Виды:Human
переносчик:pCMV3-SP-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек CD34 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек CD34 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10097-ACGRBS15400
Человек CD34 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10097-ACRRBS15400
Человек CD34 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10097-CFRBS13340
Человек CD34 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10097-CHRBS13340
Человек CD34 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10097-CMRBS13340
Человек CD34 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10097-CYRBS13340
Человек CD34 transcript variant 2 Джин клон кДНК в вектор клонированияHG10097-MRBS5130
Человек CD34 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10097-M-FRBS13340
Человек CD34 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10097-NFRBS13340
Человек CD34 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10097-NHRBS13340
Человек CD34 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10097-NMRBS13340
Человек CD34 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10097-NYRBS13340
Человек CD34 transcript variant 2 Джин ORF экспрессии кДНК клона плазмидыHG10097-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Cluster of Differentiation 34 (CD34) is a member of a family of single-pass transmembrane sialomucin proteins, and may function as a cell-cell adhesion factor. CD34 protein is selectively expressed on hematopoietic progenitor cells and the small vessel endothelium of a variety of tissues. It has been widely used as a stem and progenitor cell marker, and clinical CD34+ stem cell transplantation (CD34+SCT) has been performed for tumor purging. CD34 monoclonal antibodies are widely used to identify and isolate hemopoietic progenitors and to classify acute and chronic leukemias.

Ссылки
  • Hogan CJ, et al. (2002) Differential long-term and multilineage engraftment potential from subfractions of human CD34+ cord blood cells transplanted into NOD/SCID mice. Proc Nat Acad Sci USA. 99 (1): 413-8.
  • Nielsen JS,et al. (2009) CD34 is a key regulator of hematopoietic stem cell trafficking to bone marrow and mast cell progenitor trafficking in the periphery. Microcirculation. 16(6): 487-96.
  • Mastrandrea F,et al. (2009) CD34+ hemopoietic precursor and stem cells traffic in peripheral blood of celiac patients is significantly increased but not directly related to epithelial damage severity. Eur Ann Allergy Clin Immunol. 40(3): 90-103.
  • Pasquet S,et al. (2009) Long-term benefit of intracardiac delivery of autologous granulocyte-colony-stimulating factor-mobilized blood CD34+ cells containing cardiac progenitors on regional heart structure and function after myocardial infarct. Cytotherapy. 11(8): 1002-15.
  • Size / Price
    Каталог: HG10097-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».