Быстрый заказ

Text Size:AAA

Человек CD31/PECAM-1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human PECAM1 Информация о продукте «Клон cDNA»
Размер кДНК:2217bp
Описание кДНК:Full length Clone DNA of Homo sapiens platelet/endothelial cell adhesion molecule (PECAM1) with N terminal Myc tag.
Синоним гена:PECAM1, CD31, PECAM-1
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек CD31/PECAM-1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек CD31/PECAM-1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10148-ACGRBS16760
Человек CD31/PECAM-1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10148-ACRRBS16760
Человек CD31/PECAM-1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10148-CFRBS14710
Человек CD31/PECAM-1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10148-CHRBS14710
Человек CD31/PECAM-1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10148-CMRBS14710
Человек CD31/PECAM-1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10148-CYRBS14710
Человек CD31/PECAM-1 Джин клон кДНК в вектор клонированияHG10148-MRBS5130
Человек CD31/PECAM-1 Джин ORF экспрессии кДНК клона плазмидыHG10148-M-NRBS14710
Человек CD31/PECAM-1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10148-NFRBS14710
Человек CD31/PECAM-1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10148-NHRBS14710
Человек CD31/PECAM-1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10148-NMRBS14710
Человек CD31/PECAM-1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10148-NYRBS14710
Человек CD31/PECAM-1 Джин ORF экспрессии кДНК клона плазмидыHG10148-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name

The Cluster of Differentiation 31 (CD31) adhesion molecule, also known as platelet-endothelial cell adhesion molecule-1 (PECAM-1), is the only known member of the CAM family on platelets. CD31 protein is a 130-kDa transmembrane glycoprotein expressed by endothelial cells, platelets, monocytes, neutrophils, and certain T cell subsets. CD31 protein is also expressed in certain tumors, including epithelioid hemangioendothelioma, other vascular tumors, and histiocytic malignancies. CD31 plays a key role in removing aged neutrophils and tissue regeneration. CD31 protein mediates the homotypic or heterotypic cell adhesion by binding to itself or the leukocyte integrin αvβ3, and thus plays a role in neutrophil recruitment in inflammatory responses, transendothelial migration of leukocytes, as well as in cardiovascular development.

  • Deaglio S, et al. (2000) CD38/CD31, a receptor/ligand system ruling adhesion and signaling in human leukocytes. Chem Immunol. 75: 99-120.
  • Kohler S, et al. (2009) Life after the thymus: CD31+ and CD31- human naive CD4+ T-cell subsets. Blood. 113(4): 769-74.
  • Size / Price
    Каталог: HG10148-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.