Быстрый заказ

Человек CLM-9 / TREM4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human CD300LG Информация о продукте «Клон cDNA»
Размер кДНК:999bp
Описание кДНК:Full length Clone DNA of Homo sapiens CD300 molecule-like family member g with N terminal Flag tag.
Синоним гена:CLM9, CLM-9, TREM4, TREM-4, NEPMUCIN, CD300LG
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек CLM-9 / TREM4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Человек CLM-9 / TREM4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13365-ACGRBS15400
Человек CLM-9 / TREM4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13365-ACRRBS15400
Человек CLM-9 / TREM4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13365-CFRBS13340
Человек CLM-9 / TREM4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13365-CHRBS13340
Человек CLM-9 / TREM4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13365-CMRBS13340
Человек CLM-9 / TREM4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13365-CYRBS13340
Человек CLM-9 / TREM4 Джин клон кДНК в вектор клонированияHG13365-GRBS5130
Человек CLM-9 / TREM4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13365-NFRBS13340
Человек CLM-9 / TREM4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13365-NHRBS13340
Человек CLM-9 / TREM4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13365-NMRBS13340
Человек CLM-9 / TREM4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13365-NYRBS13340
Человек CLM-9 / TREM4 Джин ORF экспрессии кДНК клона плазмидыHG13365-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

CLM-9, also known as TREM4, is a receptor which belongs to the TREM family. The TREM family of receptors regulates the activity of various cell types of the immune system including neutrophils, monocyte/macrophages, microglia, and dendritic cells. CLM-9 may mediate L-selectin-dependent lymphocyte rollings. It binds SELL in a calcium dependent manner. CLM-9 also binds lymphocyte which suggests that it functions in lymphocyte adhesion. The major CLM-9 transcript is expressed highly in human heart, skeletal muscle, and placenta. The mouse protein has been shown to be expressed in capillary endothelial cells. Human CLM-9 mediates the uptake of human IgA2 and mouse IgM.

  • Clark GJ, et al. (2009) The CD300 molecules regulate monocyte and dendritic cell functions. Immunobiology. 214(9-10):730-6.
  • Engel K, et al. (2012) Bacterial expression of mutant argininosuccinate lyase reveals imperfect correlation of in-vitro enzyme activity with clinical phenotype in argininosuccinic aciduria. J Inherit Metab Dis. 35(1):133-40.
  • Lamesch P, et al. (2007) hORFeome v3.1: a resource of human open reading frames representing over 10,000 human genes. Genomics. 89(3):307-15.
  • Size / Price
    Каталог: HG13365-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.