After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек CD2AP Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human CD2AP Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_012120.2
Размер кДНК:1920bp
Описание кДНК:Full length Clone DNA of Homo sapiens CD2-associated protein.
Синоним гена:CMS, DKFZp586H0519, CD2AP
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек CD2AP Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек CD2AP Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13303-ACGRBS16760
Человек CD2AP Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13303-ACRRBS16760
Человек CD2AP Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG13303-ANGRBS16760
Человек CD2AP Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG13303-ANRRBS16760
Человек CD2AP Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13303-CFRBS14710
Человек CD2AP Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13303-CHRBS14710
Человек CD2AP Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13303-CMRBS14710
Человек CD2AP Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13303-CYRBS14710
Человек CD2AP Джин клон кДНК в вектор клонированияHG13303-GRBS5130
Человек CD2AP Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13303-NFRBS14710
Человек CD2AP Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13303-NHRBS14710
Человек CD2AP Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13303-NMRBS14710
Человек CD2AP Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13303-NYRBS14710
Человек CD2AP Джин ORF экспрессии кДНК клона плазмидыHG13303-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG13303-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».