Быстрый заказ

Человек CD2AP Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human CD2AP Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_012120.2
Размер кДНК:1920bp
Описание кДНК:Full length Clone DNA of Homo sapiens CD2-associated protein with C terminal Flag tag.
Синоним гена:CMS, DKFZp586H0519, CD2AP
Виды:Human
переносчик:pCMV3-C-FLAG
Plasmid:pCMV3-CD2AP-Flag
Участок рестрикции:KpnI + NotI (6kb + 1.96kb)
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 1204 C>T not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human CD2AP Gene Plasmid Map
Human CD2AP natural ORF mammalian expression plasmid, C-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек CD2AP Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Человек CD2AP Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13303-ACGRBS16760
Человек CD2AP Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13303-ACRRBS16760
Человек CD2AP Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG13303-ANGRBS16760
Человек CD2AP Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG13303-ANRRBS16760
Человек CD2AP Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13303-CFRBS14710
Человек CD2AP Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13303-CHRBS14710
Человек CD2AP Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13303-CMRBS14710
Человек CD2AP Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13303-CYRBS14710
Человек CD2AP Джин клон кДНК в вектор клонированияHG13303-GRBS5130
Человек CD2AP Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13303-NFRBS14710
Человек CD2AP Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13303-NHRBS14710
Человек CD2AP Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13303-NMRBS14710
Человек CD2AP Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13303-NYRBS14710
Человек CD2AP Джин ORF экспрессии кДНК клона плазмидыHG13303-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG13303-CF
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
НаличиеIn Stock
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
  • Human Raf-1 ORF mammalian expression plasmid, C-Flag tag
  • Human CD2AP natural ORF mammalian expression plasmid, C-Flag tag
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».