After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек B7-H3/CD276 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human CD276 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001024736.1
Размер кДНК:1605bp
Описание кДНК:Full length Clone DNA of Homo sapiens CD276 molecule transcript variant 1.
Синоним гена:B7H3, B7-H3, CD276
Виды:Human
переносчик:pCMV3-untagged
Plasmid:pCMV3-CD276
Участок рестрикции:KpnI + XbaI (6.1kb + 1.61kb)
Последовательность меток:
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human CD276 Gene Plasmid Map
Human CD276 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Человек B7-H3/CD276 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек B7-H3/CD276 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11188-ACGRBS16760
Человек B7-H3/CD276 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11188-ACRRBS16760
Человек B7-H3/CD276 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11188-CFRBS14710
Человек B7-H3/CD276 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11188-CHRBS14710
Человек B7-H3/CD276 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11188-CMRBS14710
Человек B7-H3/CD276 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11188-CYRBS14710
Человек B7-H3/CD276 transcript variant 1 Джин клон кДНК в вектор клонированияHG11188-MRBS5130
Человек B7-H3/CD276 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11188-M-FRBS14710
Человек B7-H3/CD276 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11188-NFRBS14710
Человек B7-H3/CD276 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11188-NHRBS14710
Человек B7-H3/CD276 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11188-NMRBS14710
Человек B7-H3/CD276 transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11188-NYRBS14710
Человек B7-H3/CD276 transcript variant 1 Джин ORF экспрессии кДНК клона плазмидыHG11188-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

B7-H3 is a member of the B7 family of immune regulatory ligands that is thought to attenuate peripheral immune responses through co-inhibition. It plays an important role in adaptive immune responses, and was shown to either promote or inhibit T-cell responses in various experimental systems. B7-H3 may play an important role in muscle-immune interactions, providing further evidence of the active role of muscle cells in local immunoregulatory processes. B7-H3 is a novel protein structurally related to the B7 family of ligands by the presence of a single set of immunoglobulin-V-like and immunoglobulin-C-like (VC) domains. Previous studies have correlated its overexpression with poor prognosis and decreased tumor-infiltrating lymphocytes in various carcinomas including uterine endometrioid carcinomas, and mounting evidence supports an immuno-inhibitory role in ovarian cancer prognosis. Recently, B7-H3 expression has been reported in several human cancers indicating an additional function of B7-H3 as a regulator of antitumor immunity.

Ссылки
  • Suh WK, et al. (2004) The immune regulatory protein B7-H3 promotes osteoblast differentiation and bone mineralization. Proc Natl Acad Sci U S A. 101(35): 12969-73.
  • Waschbisch A, et al. (2008) Human muscle cells express the costimulatory molecule B7-H3, which modulates muscle-immune interactions. Arthritis Rheum. 58(11): 3600-8.
  • Loos M, et al. (2010) B7-h3 and its role in antitumor immunity. Clin Dev Immunol. 2010: 683875.
  • Zang X, et al. (2010) Tumor associated endothelial expression of B7-H3 predicts survival in ovarian carcinomas. Mod Pathol. 23(8): 1104-12.
  • Sun J, et al. (2010) Clinical significance and regulation of the costimulatory molecule B7-H3 in human colorectal carcinoma. Cancer Immunol Immunother. 59(8): 1163-71.
  • Size / Price
    Каталог: HG11188-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
    • Human CD276 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».