Быстрый заказ

Человек IL2RA/IL-2RA/CD25 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек IL2RA Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_000417.1
    Размер кДНК:819bp
    Описание кДНК:Full length Clone DNA of Homo sapiens interleukin 2 receptor, alpha (IL2RA) with N terminal Myc tag.
    Синоним гена:IL2RA, CD25, IL2R, TCGFR, IDDM10
    Виды:Human
    переносчик:pCMV3-SP-N-Myc
    Plasmid:
    Участок рестрикции:
    Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with IL2RA qPCR primers for gene expression analysis, HP100234 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Человек IL2RA/IL-2RA/CD25 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
    Человек IL2RA/IL-2RA/CD25 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10165-ACGRBS15400
    Человек IL2RA/IL-2RA/CD25 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10165-ACRRBS15400
    Человек IL2RA/IL-2RA/CD25 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10165-CFRBS13340
    Человек IL2RA/IL-2RA/CD25 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10165-CHRBS13340
    Человек IL2RA/IL-2RA/CD25 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10165-CMRBS13340
    Человек IL2RA/IL-2RA/CD25 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10165-CYRBS13340
    Человек IL2RA/IL-2RA/CD25 Джин клон кДНК в вектор клонированияHG10165-MRBS5130
    Человек IL2RA/IL-2RA/CD25 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10165-M-HRBS13340
    Человек IL2RA/IL-2RA/CD25 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10165-NFRBS13340
    Человек IL2RA/IL-2RA/CD25 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10165-NHRBS13340
    Человек IL2RA/IL-2RA/CD25 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10165-NMRBS13340
    Человек IL2RA/IL-2RA/CD25 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10165-NYRBS13340
    Человек IL2RA/IL-2RA/CD25 Джин ORF экспрессии кДНК клона плазмидыHG10165-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    CD25 (alpha-chain of IL-2 receptor, or IL2RA), is a type I transmembrane glycoprotein with a signal peptide, an extracellular region, a transmembrane region, and a cytoplasmic domain. IL2RA is expressed on activated T cells and regulatory T cells, and is capable of binding IL2 with low affinity by itself. However, a ligand-induced high affinity heterotrimeric receptor complex is produced when IL2RA is associated non-covelently with the IL2 receptor beta and gamma chain, and subsequently initiates the intacellular signal pathways such as MAPK or JAK/STAT. On dendritic cells (DC), CD25 has been previously regarded as an activation marker, while both murine and human DC can express CD25, they do not express the beta-chain of the IL-2 receptor, which is indispensable for the execution of IL-2 signaling. The IL2RA (CD25) gene is a substantial component of the high-affinity receptor molecule highly expressed by activated T lymphocytes. Recently, a strong evidence was obtained for the involvement of IL-2RA in conferring susceptibility to type 1 diabetes (T1D). Cancer growth and development is associated with the stimulation of the innate immune system, including enhanced interleukin 2 receptor (IL-2R) expression in immune cells and its shedding into the circulation in a soluble form of sIL-2Ralpha. In most haematological malignancies, including different types of leukaemias and lymphomas, sIL-2Ralpha has been found to be released directly from the surface of neoplastic cells thus reflecting the tumour bulk, turnover and activity. Several studies have proved that not only lymphoid cancer cells, but also some non-lymphoid cancer cells, express IL-2R on their surface. They include malignant melanoma and carcinomas of the kidney, head and neck, oesophagus and lung. Thus, sIL-2Ralpha is elevated in most proliferative disturbances of the hematopoietic system and in many solid tumors.

    Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

    Ссылки
  • Driesen J, et al. (2008) CD25 as an immune regulatory molecule expressed on myeloid dendritic cells. Immunobiology. 213(9-10): 849-58.
  • Olejniczak K, et al. (2008) Biological properties of interleukin 2 and its role in pathogenesis of selected diseases--a review. Med Sci Monit. 14(10): RA179-89.
  • Chistiakov DA, et al. (2008) The crucial role of IL-2/IL-2RA-mediated immune regulation in the pathogenesis of type 1 diabetes, an evidence coming from genetic and animal model studies. Immunol Lett. 118(1): 1-5.
  • Bien E, et al. (2008) Serum soluble interleukin 2 receptor alpha in human cancer of adults and children: a review. Biomarkers. 13(1): 1-26.
  • Size / Price
    Каталог: HG10165-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».